Mutagenetix > Incidental Mutation

Incidental Mutation 'R3878:Szt2'

276938

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.539) question?

Stock #

R3878 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118390585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 789 (S789P)

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000075406
AA Change: S789P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: S789P

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136737

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020A23Rik	C	T	2: 130,405,640	T32M	probably benign	Het
4930402H24Rik	T	C	2: 130,778,503	R237G	possibly damaging	Het
A2ml1	T	C	6: 128,554,361	S915G	probably benign	Het
Ablim1	T	C	19: 57,037,210		probably null	Het
Cadm2	C	T	16: 66,815,441	E78K	probably damaging	Het
Ceacam5	C	T	7: 17,750,581	P416L	probably damaging	Het
Chsy3	T	C	18: 59,409,773	F661S	probably damaging	Het
Clstn3	G	A	6: 124,457,942	T338I	probably damaging	Het
Ctif	A	G	18: 75,519,977	I403T	probably damaging	Het
Eprs	T	A	1: 185,415,953		probably null	Het
Fam214b	T	G	4: 43,035,867	H288P	probably damaging	Het
Frs2	A	C	10: 117,078,910	S35A	probably benign	Het
Gpr155	C	T	2: 73,368,392	W394*	probably null	Het
Ift140	G	A	17: 25,028,944	V259M	probably benign	Het
Igkv9-124	A	T	6: 67,942,207	S74T	probably benign	Het
Krt14	C	T	11: 100,207,089	V123M	possibly damaging	Het
Mcm2	G	A	6: 88,893,008	R60C	probably damaging	Het
Nebl	T	C	2: 17,393,252	T457A	possibly damaging	Het
Nlrp4g	A	G	9: 124,349,362		noncoding transcript	Het
Nsa2	C	G	13: 97,132,034	G175A	probably benign	Het
Olfr1090	T	C	2: 86,754,628	T37A	probably benign	Het
Pax1	A	T	2: 147,362,308		probably benign	Het
Pdzd2	T	C	15: 12,376,176	E1291G	probably benign	Het
Relb	G	A	7: 19,617,844	H115Y	probably damaging	Het
Rnase10	A	G	14: 51,009,432	E52G	probably damaging	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Slc14a2	C	T	18: 78,159,074	V614I	probably benign	Het
Slc20a2	T	C	8: 22,568,383	L645P	possibly damaging	Het
Smoc2	A	G	17: 14,325,617	D56G	probably damaging	Het
Tenm2	A	G	11: 36,139,574		probably null	Het
Tm9sf3	A	G	19: 41,246,713	V169A	probably damaging	Het
Trbv13-1	C	T	6: 41,116,388	T86I	probably benign	Het
Trim24	A	G	6: 37,964,773	D886G	probably benign	Het
Trim33	A	G	3: 103,352,005	I1003M	probably damaging	Het
Trim37	T	C	11: 87,206,002	V777A	probably benign	Het
Ttc7	A	C	17: 87,370,738		probably benign	Het
Ttn	T	C	2: 76,766,020	D11856G	possibly damaging	Het
Vmn1r226	A	T	17: 20,687,998	D164V	possibly damaging	Het
Vmn1r34	G	A	6: 66,637,568	T62I	possibly damaging	Het
Wapl	T	C	14: 34,692,147	L322P	probably damaging	Het
Zfp62	A	G	11: 49,215,133	D17G	probably damaging	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCCAAACGCAGAGCCTAC -3'
(R):5'- GGTTCTTCACAAGCCACTGGAC -3'

Sequencing Primer
(F):5'- AGAGCCTACACGCGCTCTC -3'
(R):5'- TCCTCATCAGGTGGGTAAGAC -3'

Posted On

2015-04-06