Incidental Mutation 'R3878:Nlrp4g'
ID276950
Institutional Source Beutler Lab
Gene Symbol Nlrp4g
Ensembl Gene ENSMUSG00000079741
Gene NameNLR family, pyrin domain containing 4G
Synonymsnalp4g
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R3878 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location124348831-124354028 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 124349362 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000067621
SMART Domains Protein: ENSMUSP00000065508
Gene: ENSMUSG00000079741

DomainStartEndE-ValueType
Pfam:NACHT 69 238 1.5e-39 PFAM
Blast:LRR 555 582 9e-10 BLAST
Blast:LRR 610 637 7e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217183
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020A23Rik C T 2: 130,405,640 T32M probably benign Het
4930402H24Rik T C 2: 130,778,503 R237G possibly damaging Het
A2ml1 T C 6: 128,554,361 S915G probably benign Het
Ablim1 T C 19: 57,037,210 probably null Het
Cadm2 C T 16: 66,815,441 E78K probably damaging Het
Ceacam5 C T 7: 17,750,581 P416L probably damaging Het
Chsy3 T C 18: 59,409,773 F661S probably damaging Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Ctif A G 18: 75,519,977 I403T probably damaging Het
Eprs T A 1: 185,415,953 probably null Het
Fam214b T G 4: 43,035,867 H288P probably damaging Het
Frs2 A C 10: 117,078,910 S35A probably benign Het
Gpr155 C T 2: 73,368,392 W394* probably null Het
Ift140 G A 17: 25,028,944 V259M probably benign Het
Igkv9-124 A T 6: 67,942,207 S74T probably benign Het
Krt14 C T 11: 100,207,089 V123M possibly damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Nebl T C 2: 17,393,252 T457A possibly damaging Het
Nsa2 C G 13: 97,132,034 G175A probably benign Het
Olfr1090 T C 2: 86,754,628 T37A probably benign Het
Pax1 A T 2: 147,362,308 probably benign Het
Pdzd2 T C 15: 12,376,176 E1291G probably benign Het
Relb G A 7: 19,617,844 H115Y probably damaging Het
Rnase10 A G 14: 51,009,432 E52G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc14a2 C T 18: 78,159,074 V614I probably benign Het
Slc20a2 T C 8: 22,568,383 L645P possibly damaging Het
Smoc2 A G 17: 14,325,617 D56G probably damaging Het
Szt2 A G 4: 118,390,585 S789P probably damaging Het
Tenm2 A G 11: 36,139,574 probably null Het
Tm9sf3 A G 19: 41,246,713 V169A probably damaging Het
Trbv13-1 C T 6: 41,116,388 T86I probably benign Het
Trim24 A G 6: 37,964,773 D886G probably benign Het
Trim33 A G 3: 103,352,005 I1003M probably damaging Het
Trim37 T C 11: 87,206,002 V777A probably benign Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ttn T C 2: 76,766,020 D11856G possibly damaging Het
Vmn1r226 A T 17: 20,687,998 D164V possibly damaging Het
Vmn1r34 G A 6: 66,637,568 T62I possibly damaging Het
Wapl T C 14: 34,692,147 L322P probably damaging Het
Zfp62 A G 11: 49,215,133 D17G probably damaging Het
Other mutations in Nlrp4g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Nlrp4g APN 9 124349526 unclassified noncoding transcript
IGL01087:Nlrp4g APN 9 124353858 critical splice acceptor site noncoding transcript
IGL01106:Nlrp4g APN 9 124350452 unclassified noncoding transcript
IGL01938:Nlrp4g APN 9 124349068 unclassified noncoding transcript
IGL02088:Nlrp4g APN 9 124350453 unclassified noncoding transcript
IGL02170:Nlrp4g APN 9 124348980 unclassified noncoding transcript
IGL02582:Nlrp4g APN 9 124349764 unclassified noncoding transcript
IGL02588:Nlrp4g APN 9 124348843 unclassified noncoding transcript
IGL02931:Nlrp4g APN 9 124348940 unclassified noncoding transcript
IGL03111:Nlrp4g APN 9 124353978 exon noncoding transcript
IGL03373:Nlrp4g APN 9 124349853 unclassified noncoding transcript
R0617:Nlrp4g UTSW 9 124349540 unclassified noncoding transcript
R1419:Nlrp4g UTSW 9 124349434 unclassified noncoding transcript
R2060:Nlrp4g UTSW 9 124349693 unclassified noncoding transcript
R2152:Nlrp4g UTSW 9 124353339 exon noncoding transcript
R2356:Nlrp4g UTSW 9 124349306 unclassified noncoding transcript
R2384:Nlrp4g UTSW 9 124349707 unclassified noncoding transcript
R2698:Nlrp4g UTSW 9 124349630 unclassified noncoding transcript
R4640:Nlrp4g UTSW 9 124349153 unclassified noncoding transcript
R4745:Nlrp4g UTSW 9 124349515 unclassified noncoding transcript
R4754:Nlrp4g UTSW 9 124349788 unclassified noncoding transcript
R4937:Nlrp4g UTSW 9 124354005 exon noncoding transcript
R5024:Nlrp4g UTSW 9 124350155 unclassified noncoding transcript
R5162:Nlrp4g UTSW 9 124350394 unclassified noncoding transcript
R5407:Nlrp4g UTSW 9 124349930 unclassified noncoding transcript
R5521:Nlrp4g UTSW 9 124350020 unclassified noncoding transcript
Z1088:Nlrp4g UTSW 9 124349201 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- GTTGAAGACAGCCAGCCTTG -3'
(R):5'- CACCAAACTGAAGGCCTCTTG -3'

Sequencing Primer
(F):5'- GCTGAACTTATCTCCAGAGAGTG -3'
(R):5'- GGGCTCTGATCTTATCTTGGAAC -3'
Posted On2015-04-06