Incidental Mutation 'R3878:Zfp62'
ID276953
Institutional Source Beutler Lab
Gene Symbol Zfp62
Ensembl Gene ENSMUSG00000046311
Gene Namezinc finger protein 62
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R3878 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49203292-49218816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49215133 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 17 (D17G)
Ref Sequence ENSEMBL: ENSMUSP00000115849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061757] [ENSMUST00000109197] [ENSMUST00000109198] [ENSMUST00000133150] [ENSMUST00000136539] [ENSMUST00000136691] [ENSMUST00000137061] [ENSMUST00000150284] [ENSMUST00000151228] [ENSMUST00000180016]
Predicted Effect probably benign
Transcript: ENSMUST00000061757
AA Change: D17G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000056226
Gene: ENSMUSG00000046311
AA Change: D17G

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109197
AA Change: D17G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104820
Gene: ENSMUSG00000046311
AA Change: D17G

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109198
AA Change: D17G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104821
Gene: ENSMUSG00000046311
AA Change: D17G

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128932
Predicted Effect probably damaging
Transcript: ENSMUST00000133150
AA Change: D17G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000136539
AA Change: D17G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000116045
Gene: ENSMUSG00000046311
AA Change: D17G

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136691
AA Change: D17G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000137061
AA Change: D17G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000150284
Predicted Effect probably benign
Transcript: ENSMUST00000151228
AA Change: D17G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000117774
Gene: ENSMUSG00000046311
AA Change: D17G

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
Pfam:zf-C2H2_6 179 195 2.3e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157023
Predicted Effect probably benign
Transcript: ENSMUST00000180016
AA Change: D17G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137583
Gene: ENSMUSG00000046311
AA Change: D17G

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020A23Rik C T 2: 130,405,640 T32M probably benign Het
4930402H24Rik T C 2: 130,778,503 R237G possibly damaging Het
A2ml1 T C 6: 128,554,361 S915G probably benign Het
Ablim1 T C 19: 57,037,210 probably null Het
Cadm2 C T 16: 66,815,441 E78K probably damaging Het
Ceacam5 C T 7: 17,750,581 P416L probably damaging Het
Chsy3 T C 18: 59,409,773 F661S probably damaging Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Ctif A G 18: 75,519,977 I403T probably damaging Het
Eprs T A 1: 185,415,953 probably null Het
Fam214b T G 4: 43,035,867 H288P probably damaging Het
Frs2 A C 10: 117,078,910 S35A probably benign Het
Gpr155 C T 2: 73,368,392 W394* probably null Het
Ift140 G A 17: 25,028,944 V259M probably benign Het
Igkv9-124 A T 6: 67,942,207 S74T probably benign Het
Krt14 C T 11: 100,207,089 V123M possibly damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Nebl T C 2: 17,393,252 T457A possibly damaging Het
Nlrp4g A G 9: 124,349,362 noncoding transcript Het
Nsa2 C G 13: 97,132,034 G175A probably benign Het
Olfr1090 T C 2: 86,754,628 T37A probably benign Het
Pax1 A T 2: 147,362,308 probably benign Het
Pdzd2 T C 15: 12,376,176 E1291G probably benign Het
Relb G A 7: 19,617,844 H115Y probably damaging Het
Rnase10 A G 14: 51,009,432 E52G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc14a2 C T 18: 78,159,074 V614I probably benign Het
Slc20a2 T C 8: 22,568,383 L645P possibly damaging Het
Smoc2 A G 17: 14,325,617 D56G probably damaging Het
Szt2 A G 4: 118,390,585 S789P probably damaging Het
Tenm2 A G 11: 36,139,574 probably null Het
Tm9sf3 A G 19: 41,246,713 V169A probably damaging Het
Trbv13-1 C T 6: 41,116,388 T86I probably benign Het
Trim24 A G 6: 37,964,773 D886G probably benign Het
Trim33 A G 3: 103,352,005 I1003M probably damaging Het
Trim37 T C 11: 87,206,002 V777A probably benign Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ttn T C 2: 76,766,020 D11856G possibly damaging Het
Vmn1r226 A T 17: 20,687,998 D164V possibly damaging Het
Vmn1r34 G A 6: 66,637,568 T62I possibly damaging Het
Wapl T C 14: 34,692,147 L322P probably damaging Het
Other mutations in Zfp62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03342:Zfp62 APN 11 49215471 nonsense probably null
R0416:Zfp62 UTSW 11 49215676 missense probably damaging 1.00
R0540:Zfp62 UTSW 11 49215400 missense probably benign
R0607:Zfp62 UTSW 11 49215400 missense probably benign
R1119:Zfp62 UTSW 11 49216690 missense probably damaging 0.99
R1230:Zfp62 UTSW 11 49215099 missense probably damaging 0.96
R1644:Zfp62 UTSW 11 49215769 missense probably damaging 0.99
R1710:Zfp62 UTSW 11 49217683 missense probably benign
R1840:Zfp62 UTSW 11 49216388 missense probably damaging 1.00
R1908:Zfp62 UTSW 11 49216220 missense probably damaging 0.99
R4571:Zfp62 UTSW 11 49215741 missense probably damaging 1.00
R4571:Zfp62 UTSW 11 49215742 missense probably damaging 1.00
R4580:Zfp62 UTSW 11 49216272 missense possibly damaging 0.91
R4631:Zfp62 UTSW 11 49217805 makesense probably null
R5022:Zfp62 UTSW 11 49215729 missense probably damaging 0.96
R5023:Zfp62 UTSW 11 49215729 missense probably damaging 0.96
R5289:Zfp62 UTSW 11 49217148 missense probably damaging 0.98
R5362:Zfp62 UTSW 11 49216612 missense probably damaging 1.00
R5685:Zfp62 UTSW 11 49216217 nonsense probably null
R6420:Zfp62 UTSW 11 49216513 missense probably damaging 1.00
R6764:Zfp62 UTSW 11 49215169 missense probably damaging 0.99
R7000:Zfp62 UTSW 11 49216379 nonsense probably null
R7016:Zfp62 UTSW 11 49215937 missense probably damaging 0.98
R7175:Zfp62 UTSW 11 49216753 missense probably damaging 0.99
R7670:Zfp62 UTSW 11 49215076 start gained probably benign
R7675:Zfp62 UTSW 11 49216020 missense possibly damaging 0.75
R7686:Zfp62 UTSW 11 49217158 missense probably damaging 1.00
X0011:Zfp62 UTSW 11 49215598 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTTTGTGCATCAGTTGAACC -3'
(R):5'- AGATGTCTCATCATCCTGCTCTAG -3'

Sequencing Primer
(F):5'- AGTTCCAGAGGGATCTGACTACCTC -3'
(R):5'- CTGCTCTAGTTTTATATTTGCTGCG -3'
Posted On2015-04-06