Incidental Mutation 'R3838:Dnajb2'
ID276971
Institutional Source Beutler Lab
Gene Symbol Dnajb2
Ensembl Gene ENSMUSG00000026203
Gene NameDnaJ heat shock protein family (Hsp40) member B2
SynonymsmDj8, 2700059H22Rik, Dnajb10
MMRRC Submission 040779-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3838 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75236406-75245692 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 75241480 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055223] [ENSMUST00000082158] [ENSMUST00000185403] [ENSMUST00000185654] [ENSMUST00000187058] [ENSMUST00000188290] [ENSMUST00000188346] [ENSMUST00000188931]
Predicted Effect probably null
Transcript: ENSMUST00000055223
SMART Domains Protein: ENSMUSP00000052520
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 1.46e-29 SMART
low complexity region 67 78 N/A INTRINSIC
low complexity region 119 148 N/A INTRINSIC
UIM 189 208 3.05e1 SMART
UIM 232 251 5.19e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000082158
SMART Domains Protein: ENSMUSP00000080796
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185403
SMART Domains Protein: ENSMUSP00000139982
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 2.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185654
SMART Domains Protein: ENSMUSP00000140456
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 1.3e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186600
Predicted Effect probably null
Transcript: ENSMUST00000187058
SMART Domains Protein: ENSMUSP00000140637
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 1.46e-29 SMART
low complexity region 67 78 N/A INTRINSIC
low complexity region 119 148 N/A INTRINSIC
UIM 189 208 3.05e1 SMART
UIM 232 251 5.19e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188290
SMART Domains Protein: ENSMUSP00000140634
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188346
SMART Domains Protein: ENSMUSP00000140588
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188628
Predicted Effect probably null
Transcript: ENSMUST00000188931
SMART Domains Protein: ENSMUSP00000140566
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190379
Predicted Effect probably benign
Transcript: ENSMUST00000190445
Meta Mutation Damage Score 0.9593 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is almost exclusively expressed in the brain, mainly in the neuronal layers. It encodes a protein that shows sequence similarity to bacterial DnaJ protein and the yeast homologs. In bacteria, this protein is implicated in protein folding and protein complex dissociation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,521 T41A probably benign Het
4930486L24Rik A G 13: 60,845,227 Y213H probably damaging Het
Alg8 C T 7: 97,388,545 H379Y probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Arid4a A G 12: 71,075,785 E980G possibly damaging Het
Aspm C T 1: 139,478,054 H1560Y probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
Bud13 A C 9: 46,290,192 Q387P possibly damaging Het
Champ1 A G 8: 13,879,939 Y699C probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Col2a1 T C 15: 97,988,976 D345G unknown Het
Col2a1 A T 15: 98,000,581 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Dock4 G T 12: 40,794,624 probably null Het
Epx A T 11: 87,874,830 L101Q probably damaging Het
F13a1 A T 13: 37,047,424 N21K probably damaging Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a T C 14: 34,245,368 D77G probably benign Het
Foxj3 T A 4: 119,616,624 H215Q possibly damaging Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Ighmbp2 T C 19: 3,271,658 Y367C probably benign Het
Lrrc14b A G 13: 74,363,545 C139R possibly damaging Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msn C A X: 96,160,199 Q303K probably damaging Het
Myh7b A G 2: 155,632,989 K1816E probably damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nme2 T A 11: 93,949,977 E252D probably benign Het
Ntpcr G A 8: 125,737,372 V79M probably damaging Het
Ogdh C T 11: 6,338,627 R235* probably null Het
Olfr1490 A G 19: 13,654,957 D176G probably benign Het
Olfr825 C A 10: 130,162,406 E307* probably null Het
Olfr959 A G 9: 39,572,971 V96A probably benign Het
Pcdh20 T C 14: 88,468,463 N467S probably benign Het
Pkhd1 G A 1: 20,534,629 T1154I possibly damaging Het
Polq G T 16: 37,078,349 R2157I probably damaging Het
Reep6 C A 10: 80,335,889 A533E probably damaging Het
Senp2 T C 16: 22,009,735 S32P probably damaging Het
Sept11 T A 5: 93,148,399 I52N probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Spdye4b C T 5: 143,192,329 T11I probably benign Het
Srrt C T 5: 137,302,125 probably null Het
Sspo T A 6: 48,480,820 C3085S probably damaging Het
Stim1 C T 7: 102,411,296 T182I possibly damaging Het
Thbs2 C A 17: 14,687,851 V217L probably benign Het
Thpo G A 16: 20,728,748 R38C probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Trim12c T A 7: 104,340,868 probably benign Het
Tvp23b A G 11: 62,883,629 H33R possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r73 A G 7: 85,858,050 W685R probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp715 A G 7: 43,299,756 V260A probably benign Het
Other mutations in Dnajb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Dnajb2 APN 1 75236890 missense probably damaging 1.00
R0494:Dnajb2 UTSW 1 75239634 unclassified probably benign
R2118:Dnajb2 UTSW 1 75237477 missense probably damaging 1.00
R3837:Dnajb2 UTSW 1 75241480 critical splice donor site probably null
R3839:Dnajb2 UTSW 1 75241480 critical splice donor site probably null
R4105:Dnajb2 UTSW 1 75236899 nonsense probably null
R4108:Dnajb2 UTSW 1 75236899 nonsense probably null
R4858:Dnajb2 UTSW 1 75243554 missense possibly damaging 0.96
R7115:Dnajb2 UTSW 1 75243662 missense
R7960:Dnajb2 UTSW 1 75241411 missense
R8248:Dnajb2 UTSW 1 75243582 missense
R8512:Dnajb2 UTSW 1 75241431 missense
R8537:Dnajb2 UTSW 1 75239598 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCACCACCTTTGTCCAAG -3'
(R):5'- ACAGGTACATTAATGGGCTCATGG -3'

Sequencing Primer
(F):5'- GCAGGTGAGCTCTCCTTCTG -3'
(R):5'- TAAAGTGCAGGCTCTCAGGC -3'
Posted On2015-04-06