Incidental Mutation 'R3838:Tmem210'
ID276974
Institutional Source Beutler Lab
Gene Symbol Tmem210
Ensembl Gene ENSMUSG00000026963
Gene Nametransmembrane protein 210
Synonyms
MMRRC Submission 040779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R3838 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25288145-25289189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25288432 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 35 (E35G)
Ref Sequence ENSEMBL: ENSMUSP00000028340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028335] [ENSMUST00000028337] [ENSMUST00000028340] [ENSMUST00000028341] [ENSMUST00000114307] [ENSMUST00000114308] [ENSMUST00000114310] [ENSMUST00000114312] [ENSMUST00000114314] [ENSMUST00000114317] [ENSMUST00000114318]
Predicted Effect probably benign
Transcript: ENSMUST00000028335
SMART Domains Protein: ENSMUSP00000028335
Gene: ENSMUSG00000026959

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 6.6e-35 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 1.5e-18 PFAM
PDB:3BYA|B 875 898 4e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000028337
SMART Domains Protein: ENSMUSP00000028337
Gene: ENSMUSG00000026961

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 42 75 1.86e0 SMART
LRR 72 93 7.57e0 SMART
LRR 95 117 6.96e0 SMART
LRR_TYP 118 141 1e-5 SMART
LRR 142 165 6.22e0 SMART
LRR 166 189 2.86e-1 SMART
LRRCT 201 254 3.01e-5 SMART
transmembrane domain 267 289 N/A INTRINSIC
low complexity region 293 308 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000028340
AA Change: E35G

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028340
Gene: ENSMUSG00000026963
AA Change: E35G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:TMEM210 32 144 1.1e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028341
SMART Domains Protein: ENSMUSP00000028341
Gene: ENSMUSG00000026965

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 123 133 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 221 229 N/A INTRINSIC
low complexity region 456 467 N/A INTRINSIC
CULLIN 515 663 6.72e-9 SMART
APC2 772 832 3.67e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114307
SMART Domains Protein: ENSMUSP00000109946
Gene: ENSMUSG00000026959

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 1e-34 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 3.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114308
SMART Domains Protein: ENSMUSP00000109947
Gene: ENSMUSG00000026959

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 8e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114310
SMART Domains Protein: ENSMUSP00000109949
Gene: ENSMUSG00000026959

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 39 299 3.6e-24 PFAM
Blast:PBPe 352 420 9e-37 BLAST
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 8.4e-17 PFAM
PDB:3BYA|B 896 919 4e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114312
SMART Domains Protein: ENSMUSP00000109951
Gene: ENSMUSG00000026959

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 5.9e-35 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 1.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114314
SMART Domains Protein: ENSMUSP00000109953
Gene: ENSMUSG00000026959

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 1.1e-34 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 3.3e-19 PFAM
PDB:3BYA|B 875 898 4e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114317
SMART Domains Protein: ENSMUSP00000109956
Gene: ENSMUSG00000026959

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 7.7e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114318
SMART Domains Protein: ENSMUSP00000109957
Gene: ENSMUSG00000026959

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 8.4e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.4e-19 PFAM
PDB:3BYA|B 896 919 4e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144102
Meta Mutation Damage Score 0.0801 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,521 T41A probably benign Het
4930486L24Rik A G 13: 60,845,227 Y213H probably damaging Het
Alg8 C T 7: 97,388,545 H379Y probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Arid4a A G 12: 71,075,785 E980G possibly damaging Het
Aspm C T 1: 139,478,054 H1560Y probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
Bud13 A C 9: 46,290,192 Q387P possibly damaging Het
Champ1 A G 8: 13,879,939 Y699C probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Col2a1 T C 15: 97,988,976 D345G unknown Het
Col2a1 A T 15: 98,000,581 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Dnajb2 G A 1: 75,241,480 probably null Het
Dock4 G T 12: 40,794,624 probably null Het
Epx A T 11: 87,874,830 L101Q probably damaging Het
F13a1 A T 13: 37,047,424 N21K probably damaging Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a T C 14: 34,245,368 D77G probably benign Het
Foxj3 T A 4: 119,616,624 H215Q possibly damaging Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Ighmbp2 T C 19: 3,271,658 Y367C probably benign Het
Lrrc14b A G 13: 74,363,545 C139R possibly damaging Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msn C A X: 96,160,199 Q303K probably damaging Het
Myh7b A G 2: 155,632,989 K1816E probably damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nme2 T A 11: 93,949,977 E252D probably benign Het
Ntpcr G A 8: 125,737,372 V79M probably damaging Het
Ogdh C T 11: 6,338,627 R235* probably null Het
Olfr1490 A G 19: 13,654,957 D176G probably benign Het
Olfr825 C A 10: 130,162,406 E307* probably null Het
Olfr959 A G 9: 39,572,971 V96A probably benign Het
Pcdh20 T C 14: 88,468,463 N467S probably benign Het
Pkhd1 G A 1: 20,534,629 T1154I possibly damaging Het
Polq G T 16: 37,078,349 R2157I probably damaging Het
Reep6 C A 10: 80,335,889 A533E probably damaging Het
Senp2 T C 16: 22,009,735 S32P probably damaging Het
Sept11 T A 5: 93,148,399 I52N probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Spdye4b C T 5: 143,192,329 T11I probably benign Het
Srrt C T 5: 137,302,125 probably null Het
Sspo T A 6: 48,480,820 C3085S probably damaging Het
Stim1 C T 7: 102,411,296 T182I possibly damaging Het
Thbs2 C A 17: 14,687,851 V217L probably benign Het
Thpo G A 16: 20,728,748 R38C probably damaging Het
Trim12c T A 7: 104,340,868 probably benign Het
Tvp23b A G 11: 62,883,629 H33R possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r73 A G 7: 85,858,050 W685R probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp715 A G 7: 43,299,756 V260A probably benign Het
Other mutations in Tmem210
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02651:Tmem210 APN 2 25289089 missense possibly damaging 0.71
R0135:Tmem210 UTSW 2 25288468 missense probably damaging 0.99
R1758:Tmem210 UTSW 2 25288423 missense probably damaging 0.96
R3837:Tmem210 UTSW 2 25288432 missense possibly damaging 0.60
R6170:Tmem210 UTSW 2 25288764 critical splice acceptor site probably null
R6348:Tmem210 UTSW 2 25288784 missense probably benign 0.27
R6349:Tmem210 UTSW 2 25289036 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCCTTGGCCTGATATGTCTG -3'
(R):5'- ATGACTAACAGCCCAGGGTC -3'

Sequencing Primer
(F):5'- GGCCTGATATGTCTGTCCCTTTTG -3'
(R):5'- TAACAGCCCAGGGTCAGTAGTAC -3'
Posted On2015-04-06