Mutagenetix > Incidental Mutation

Incidental Mutation 'R3838:Col9a2'

276980

Institutional Source

Beutler Lab

Gene Symbol

Col9a2

Ensembl Gene

ENSMUSG00000028626

Gene Name

collagen, type IX, alpha 2

Synonyms

Col9a-2

MMRRC Submission

040779-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3838 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121039385-121055322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 121054258 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 599 (R599G)

Ref Sequence

ENSEMBL: ENSMUSP00000030372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030372] [ENSMUST00000058754]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000030372
AA Change: R599G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: R599G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Collagen	24	82	7.3e-12	PFAM
Pfam:Collagen	59	115	2.4e-10	PFAM
Pfam:Collagen	113	170	2e-8	PFAM
Pfam:Collagen	176	236	8.9e-11	PFAM
low complexity region	258	277	N/A	INTRINSIC
low complexity region	288	315	N/A	INTRINSIC
Pfam:Collagen	357	435	4.4e-8	PFAM
Pfam:Collagen	459	523	6.1e-11	PFAM
Pfam:Collagen	548	610	4.5e-11	PFAM
low complexity region	639	661	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000058754

SMART Domains

Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M48_N	41	225	2.5e-70	PFAM
Pfam:Peptidase_M48	228	473	5.5e-75	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140119

Meta Mutation Damage Score

0.3183

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.8%
20x: 96.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700042G07Rik	A	G	4: 116,173,521	T41A	probably benign	Het
4930486L24Rik	A	G	13: 60,845,227	Y213H	probably damaging	Het
Alg8	C	T	7: 97,388,545	H379Y	probably damaging	Het
Arhgef25	T	C	10: 127,189,736	T12A	probably benign	Het
Arid4a	A	G	12: 71,075,785	E980G	possibly damaging	Het
Aspm	C	T	1: 139,478,054	H1560Y	probably benign	Het
Atg10	A	T	13: 90,937,380	I150K	probably damaging	Het
Bud13	A	C	9: 46,290,192	Q387P	possibly damaging	Het
Champ1	A	G	8: 13,879,939	Y699C	probably damaging	Het
Clstn1	A	G	4: 149,638,333	E476G	probably damaging	Het
Col2a1	T	C	15: 97,988,976	D345G	unknown	Het
Col2a1	A	T	15: 98,000,581		probably benign	Het
Dnajb2	G	A	1: 75,241,480		probably null	Het
Dock4	G	T	12: 40,794,624		probably null	Het
Epx	A	T	11: 87,874,830	L101Q	probably damaging	Het
F13a1	A	T	13: 37,047,424	N21K	probably damaging	Het
Fam13c	C	T	10: 70,542,648	S336L	probably damaging	Het
Fam35a	T	C	14: 34,245,368	D77G	probably benign	Het
Foxj3	T	A	4: 119,616,624	H215Q	possibly damaging	Het
Gcnt4	A	T	13: 96,947,014	R273*	probably null	Het
Gpam	T	C	19: 55,080,458	N450S	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hmcn2	T	C	2: 31,413,407	L3020P	probably damaging	Het
Hmgcr	A	G	13: 96,659,089	I324T	probably benign	Het
Ighmbp2	T	C	19: 3,271,658	Y367C	probably benign	Het
Lrrc14b	A	G	13: 74,363,545	C139R	possibly damaging	Het
Lsamp	A	T	16: 42,134,312	E174V	possibly damaging	Het
Mid1ip1	T	C	X: 10,718,381	V51A	possibly damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Msn	C	A	X: 96,160,199	Q303K	probably damaging	Het
Myh7b	A	G	2: 155,632,989	K1816E	probably damaging	Het
Nap1l1	T	A	10: 111,495,322		probably null	Het
Nme2	T	A	11: 93,949,977	E252D	probably benign	Het
Ntpcr	G	A	8: 125,737,372	V79M	probably damaging	Het
Ogdh	C	T	11: 6,338,627	R235*	probably null	Het
Olfr1490	A	G	19: 13,654,957	D176G	probably benign	Het
Olfr825	C	A	10: 130,162,406	E307*	probably null	Het
Olfr959	A	G	9: 39,572,971	V96A	probably benign	Het
Pcdh20	T	C	14: 88,468,463	N467S	probably benign	Het
Pkhd1	G	A	1: 20,534,629	T1154I	possibly damaging	Het
Polq	G	T	16: 37,078,349	R2157I	probably damaging	Het
Reep6	C	A	10: 80,335,889	A533E	probably damaging	Het
Senp2	T	C	16: 22,009,735	S32P	probably damaging	Het
Sept11	T	A	5: 93,148,399	I52N	probably damaging	Het
Slc17a4	C	T	13: 23,901,769	R387H	probably benign	Het
Spdye4b	C	T	5: 143,192,329	T11I	probably benign	Het
Srrt	C	T	5: 137,302,125		probably null	Het
Sspo	T	A	6: 48,480,820	C3085S	probably damaging	Het
Stim1	C	T	7: 102,411,296	T182I	possibly damaging	Het
Thbs2	C	A	17: 14,687,851	V217L	probably benign	Het
Thpo	G	A	16: 20,728,748	R38C	probably damaging	Het
Tmem210	A	G	2: 25,288,432	E35G	possibly damaging	Het
Trim12c	T	A	7: 104,340,868		probably benign	Het
Tvp23b	A	G	11: 62,883,629	H33R	possibly damaging	Het
Usp14	A	G	18: 10,024,532		probably null	Het
Vmn2r73	A	G	7: 85,858,050	W685R	probably benign	Het
Zfp618	G	A	4: 63,133,564	A861T	probably benign	Het
Zfp715	A	G	7: 43,299,756	V260A	probably benign	Het

Other mutations in Col9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01331:Col9a2	APN	4	121045192	missense	possibly damaging	0.95
IGL01978:Col9a2	APN	4	121044666	missense	unknown
IGL01995:Col9a2	APN	4	121050410	critical splice donor site	probably null
IGL02162:Col9a2	APN	4	121054334	unclassified	probably benign
IGL02931:Col9a2	APN	4	121053192	missense	probably benign	0.06
collision	UTSW	4	121049716	critical splice donor site	probably null
gravity_wave	UTSW	4	121044019	critical splice donor site	probably null
R0208:Col9a2	UTSW	4	121052288	splice site	probably benign
R0426:Col9a2	UTSW	4	121044660	splice site	probably benign
R0512:Col9a2	UTSW	4	121054307	missense	probably benign	0.22
R0973:Col9a2	UTSW	4	121039788	critical splice donor site	probably null
R1023:Col9a2	UTSW	4	121044010	missense	unknown
R1657:Col9a2	UTSW	4	121040974	missense	unknown
R1724:Col9a2	UTSW	4	121053902	missense	probably damaging	1.00
R2171:Col9a2	UTSW	4	121045001	nonsense	probably null
R2206:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2221:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2223:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2273:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2274:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2275:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2354:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2392:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2393:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2394:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3421:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3426:Col9a2	UTSW	4	121050407	missense	possibly damaging	0.93
R3710:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3821:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3839:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4067:Col9a2	UTSW	4	121052389	missense	probably damaging	1.00
R4298:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4299:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4595:Col9a2	UTSW	4	121045155	missense	probably benign	0.04
R4942:Col9a2	UTSW	4	121053119	missense	possibly damaging	0.73
R5120:Col9a2	UTSW	4	121039772	missense	unknown
R5434:Col9a2	UTSW	4	121040965	nonsense	probably null
R6143:Col9a2	UTSW	4	121053863	missense	probably damaging	0.99
R7027:Col9a2	UTSW	4	121044019	critical splice donor site	probably null
R7056:Col9a2	UTSW	4	121049716	critical splice donor site	probably null
R7417:Col9a2	UTSW	4	121054292	missense	not run
R7571:Col9a2	UTSW	4	121039784	missense	unknown
R9120:Col9a2	UTSW	4	121043754	splice site	probably benign
R9341:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9343:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9389:Col9a2	UTSW	4	121054751	missense	probably benign	0.00
R9527:Col9a2	UTSW	4	121042331	critical splice donor site	probably null
R9620:Col9a2	UTSW	4	121053206	critical splice donor site	probably null
R9784:Col9a2	UTSW	4	121041029	missense	unknown
Z1176:Col9a2	UTSW	4	121053797	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATACAGAACCTCCCAAATCTTATCTGG -3'
(R):5'- TCAAGAGTCCCAACTGCCAG -3'

Sequencing Primer
(F):5'- AACCTCCCAAATCTTATCTGGATCTC -3'
(R):5'- AGAGACACCTCCAGCTTGG -3'

Posted On

2015-04-06