Incidental Mutation 'R3838:Clstn1'
ID276982
Institutional Source Beutler Lab
Gene Symbol Clstn1
Ensembl Gene ENSMUSG00000039953
Gene Namecalsyntenin 1
SynonymsCst-1, calsyntenin-1, 1810034E21Rik, alcadein alpha
MMRRC Submission 040779-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3838 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location149586468-149648899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149638333 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 476 (E476G)
Ref Sequence ENSEMBL: ENSMUSP00000101316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039144] [ENSMUST00000105691]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039144
AA Change: E486G

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036962
Gene: ENSMUSG00000039953
AA Change: E486G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 59 162 1.25e-11 SMART
CA 185 263 1.03e-3 SMART
Pfam:Laminin_G_3 365 510 3.3e-9 PFAM
low complexity region 663 674 N/A INTRINSIC
transmembrane domain 860 882 N/A INTRINSIC
coiled coil region 915 949 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105691
AA Change: E476G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101316
Gene: ENSMUSG00000039953
AA Change: E476G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 59 152 2.91e-12 SMART
CA 175 253 1.03e-3 SMART
Pfam:Laminin_G_3 350 544 1.1e-12 PFAM
low complexity region 653 664 N/A INTRINSIC
transmembrane domain 850 872 N/A INTRINSIC
coiled coil region 905 939 N/A INTRINSIC
Meta Mutation Damage Score 0.2863 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calsyntenin family, a subset of the cadherin superfamily. The encoded transmembrane protein, also known as alcadein-alpha, is thought to bind to kinesin-1 motors to mediate the axonal anterograde transport of certain types of vesicle. Amyloid precursor protein (APP) is trafficked via these vesicles and so this protein is being investigated to see how it might contribute to the mechanisms underlying Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Juvenile mice homozygous for a null allele show reduced basal excitatory synaptic transmission, abnormal excitatory postsynaptic currents, enhanced NMDA receptor-dependent long term potentiation, and delayed dendritic spine maturation in CA1 hippocampal pyramidal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,521 T41A probably benign Het
4930486L24Rik A G 13: 60,845,227 Y213H probably damaging Het
Alg8 C T 7: 97,388,545 H379Y probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Arid4a A G 12: 71,075,785 E980G possibly damaging Het
Aspm C T 1: 139,478,054 H1560Y probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
Bud13 A C 9: 46,290,192 Q387P possibly damaging Het
Champ1 A G 8: 13,879,939 Y699C probably damaging Het
Col2a1 T C 15: 97,988,976 D345G unknown Het
Col2a1 A T 15: 98,000,581 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Dnajb2 G A 1: 75,241,480 probably null Het
Dock4 G T 12: 40,794,624 probably null Het
Epx A T 11: 87,874,830 L101Q probably damaging Het
F13a1 A T 13: 37,047,424 N21K probably damaging Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a T C 14: 34,245,368 D77G probably benign Het
Foxj3 T A 4: 119,616,624 H215Q possibly damaging Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Ighmbp2 T C 19: 3,271,658 Y367C probably benign Het
Lrrc14b A G 13: 74,363,545 C139R possibly damaging Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msn C A X: 96,160,199 Q303K probably damaging Het
Myh7b A G 2: 155,632,989 K1816E probably damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nme2 T A 11: 93,949,977 E252D probably benign Het
Ntpcr G A 8: 125,737,372 V79M probably damaging Het
Ogdh C T 11: 6,338,627 R235* probably null Het
Olfr1490 A G 19: 13,654,957 D176G probably benign Het
Olfr825 C A 10: 130,162,406 E307* probably null Het
Olfr959 A G 9: 39,572,971 V96A probably benign Het
Pcdh20 T C 14: 88,468,463 N467S probably benign Het
Pkhd1 G A 1: 20,534,629 T1154I possibly damaging Het
Polq G T 16: 37,078,349 R2157I probably damaging Het
Reep6 C A 10: 80,335,889 A533E probably damaging Het
Senp2 T C 16: 22,009,735 S32P probably damaging Het
Sept11 T A 5: 93,148,399 I52N probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Spdye4b C T 5: 143,192,329 T11I probably benign Het
Srrt C T 5: 137,302,125 probably null Het
Sspo T A 6: 48,480,820 C3085S probably damaging Het
Stim1 C T 7: 102,411,296 T182I possibly damaging Het
Thbs2 C A 17: 14,687,851 V217L probably benign Het
Thpo G A 16: 20,728,748 R38C probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Trim12c T A 7: 104,340,868 probably benign Het
Tvp23b A G 11: 62,883,629 H33R possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r73 A G 7: 85,858,050 W685R probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp715 A G 7: 43,299,756 V260A probably benign Het
Other mutations in Clstn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clstn1 APN 4 149635243 missense probably damaging 0.99
IGL00585:Clstn1 APN 4 149638312 missense probably benign 0.05
IGL00911:Clstn1 APN 4 149643191 splice site probably benign
IGL01394:Clstn1 APN 4 149634782 missense possibly damaging 0.87
IGL02193:Clstn1 APN 4 149645352 missense probably benign 0.03
IGL02406:Clstn1 APN 4 149627359 missense probably damaging 1.00
IGL02501:Clstn1 APN 4 149631842 missense probably damaging 1.00
IGL02641:Clstn1 APN 4 149629511 missense probably null 1.00
R0012:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0020:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0021:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0026:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0031:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0038:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0062:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0064:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0193:Clstn1 UTSW 4 149634796 missense probably damaging 0.96
R0279:Clstn1 UTSW 4 149643674 missense probably damaging 1.00
R0394:Clstn1 UTSW 4 149644178 missense probably benign 0.00
R0609:Clstn1 UTSW 4 149629300 splice site probably null
R0685:Clstn1 UTSW 4 149646855 missense probably benign 0.24
R0724:Clstn1 UTSW 4 149643624 missense possibly damaging 0.84
R1016:Clstn1 UTSW 4 149646829 missense probably benign 0.21
R1470:Clstn1 UTSW 4 149634722 missense possibly damaging 0.94
R1470:Clstn1 UTSW 4 149634722 missense possibly damaging 0.94
R1622:Clstn1 UTSW 4 149629407 missense probably damaging 0.97
R1680:Clstn1 UTSW 4 149643726 missense probably benign 0.02
R3803:Clstn1 UTSW 4 149635339 missense probably damaging 0.99
R3836:Clstn1 UTSW 4 149638333 missense probably damaging 1.00
R4923:Clstn1 UTSW 4 149645029 missense probably benign 0.07
R5024:Clstn1 UTSW 4 149635294 missense possibly damaging 0.91
R5919:Clstn1 UTSW 4 149635246 missense probably damaging 1.00
R6269:Clstn1 UTSW 4 149644067 missense probably benign 0.00
R6354:Clstn1 UTSW 4 149643216 missense probably benign 0.05
R6382:Clstn1 UTSW 4 149626120 splice site probably null
R6573:Clstn1 UTSW 4 149643689 missense probably damaging 1.00
R7342:Clstn1 UTSW 4 149629430 missense probably damaging 0.98
R7457:Clstn1 UTSW 4 149634916 missense probably benign 0.03
R7571:Clstn1 UTSW 4 149646287 missense probably benign 0.38
R7682:Clstn1 UTSW 4 149626101 missense possibly damaging 0.72
R7738:Clstn1 UTSW 4 149635354 missense probably damaging 1.00
R7803:Clstn1 UTSW 4 149631871 missense probably damaging 1.00
R7904:Clstn1 UTSW 4 149614137 missense probably benign 0.01
R7918:Clstn1 UTSW 4 149644051 missense probably damaging 0.98
R8007:Clstn1 UTSW 4 149631848 missense probably damaging 1.00
X0020:Clstn1 UTSW 4 149635251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTCATTCCTACGCGTGAC -3'
(R):5'- AATCGATGACATGACTAGTGTTCC -3'

Sequencing Primer
(F):5'- ACGCGTGACTCATCTTCTGGG -3'
(R):5'- GACTAGTGTTCCCTAAAAGGCTACG -3'
Posted On2015-04-06