Mutagenetix > Incidental Mutation

Incidental Mutation 'R3838:Clstn1'

276982

Institutional Source

Beutler Lab

Gene Symbol

Clstn1

Ensembl Gene

ENSMUSG00000039953

Gene Name

calsyntenin 1

Synonyms

Cst-1, calsyntenin-1, 1810034E21Rik, alcadein alpha

MMRRC Submission

040779-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3838 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

149586468-149648899 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 149638333 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 476 (E476G)

Ref Sequence

ENSEMBL: ENSMUSP00000101316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039144] [ENSMUST00000105691]

AlphaFold

Q9EPL2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039144
AA Change: E486G

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000036962
Gene: ENSMUSG00000039953
AA Change: E486G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	59	162	1.25e-11	SMART
CA	185	263	1.03e-3	SMART
Pfam:Laminin_G_3	365	510	3.3e-9	PFAM
low complexity region	663	674	N/A	INTRINSIC
transmembrane domain	860	882	N/A	INTRINSIC
coiled coil region	915	949	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105691
AA Change: E476G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101316
Gene: ENSMUSG00000039953
AA Change: E476G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	59	152	2.91e-12	SMART
CA	175	253	1.03e-3	SMART
Pfam:Laminin_G_3	350	544	1.1e-12	PFAM
low complexity region	653	664	N/A	INTRINSIC
transmembrane domain	850	872	N/A	INTRINSIC
coiled coil region	905	939	N/A	INTRINSIC

Meta Mutation Damage Score

0.2863

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.8%
20x: 96.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calsyntenin family, a subset of the cadherin superfamily. The encoded transmembrane protein, also known as alcadein-alpha, is thought to bind to kinesin-1 motors to mediate the axonal anterograde transport of certain types of vesicle. Amyloid precursor protein (APP) is trafficked via these vesicles and so this protein is being investigated to see how it might contribute to the mechanisms underlying Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Juvenile mice homozygous for a null allele show reduced basal excitatory synaptic transmission, abnormal excitatory postsynaptic currents, enhanced NMDA receptor-dependent long term potentiation, and delayed dendritic spine maturation in CA1 hippocampal pyramidal cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700042G07Rik	A	G	4: 116,173,521	T41A	probably benign	Het
4930486L24Rik	A	G	13: 60,845,227	Y213H	probably damaging	Het
Alg8	C	T	7: 97,388,545	H379Y	probably damaging	Het
Arhgef25	T	C	10: 127,189,736	T12A	probably benign	Het
Arid4a	A	G	12: 71,075,785	E980G	possibly damaging	Het
Aspm	C	T	1: 139,478,054	H1560Y	probably benign	Het
Atg10	A	T	13: 90,937,380	I150K	probably damaging	Het
Bud13	A	C	9: 46,290,192	Q387P	possibly damaging	Het
Champ1	A	G	8: 13,879,939	Y699C	probably damaging	Het
Col2a1	T	C	15: 97,988,976	D345G	unknown	Het
Col2a1	A	T	15: 98,000,581		probably benign	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Dnajb2	G	A	1: 75,241,480		probably null	Het
Dock4	G	T	12: 40,794,624		probably null	Het
Epx	A	T	11: 87,874,830	L101Q	probably damaging	Het
F13a1	A	T	13: 37,047,424	N21K	probably damaging	Het
Fam13c	C	T	10: 70,542,648	S336L	probably damaging	Het
Fam35a	T	C	14: 34,245,368	D77G	probably benign	Het
Foxj3	T	A	4: 119,616,624	H215Q	possibly damaging	Het
Gcnt4	A	T	13: 96,947,014	R273*	probably null	Het
Gpam	T	C	19: 55,080,458	N450S	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hmcn2	T	C	2: 31,413,407	L3020P	probably damaging	Het
Hmgcr	A	G	13: 96,659,089	I324T	probably benign	Het
Ighmbp2	T	C	19: 3,271,658	Y367C	probably benign	Het
Lrrc14b	A	G	13: 74,363,545	C139R	possibly damaging	Het
Lsamp	A	T	16: 42,134,312	E174V	possibly damaging	Het
Mid1ip1	T	C	X: 10,718,381	V51A	possibly damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Msn	C	A	X: 96,160,199	Q303K	probably damaging	Het
Myh7b	A	G	2: 155,632,989	K1816E	probably damaging	Het
Nap1l1	T	A	10: 111,495,322		probably null	Het
Nme2	T	A	11: 93,949,977	E252D	probably benign	Het
Ntpcr	G	A	8: 125,737,372	V79M	probably damaging	Het
Ogdh	C	T	11: 6,338,627	R235*	probably null	Het
Olfr1490	A	G	19: 13,654,957	D176G	probably benign	Het
Olfr825	C	A	10: 130,162,406	E307*	probably null	Het
Olfr959	A	G	9: 39,572,971	V96A	probably benign	Het
Pcdh20	T	C	14: 88,468,463	N467S	probably benign	Het
Pkhd1	G	A	1: 20,534,629	T1154I	possibly damaging	Het
Polq	G	T	16: 37,078,349	R2157I	probably damaging	Het
Reep6	C	A	10: 80,335,889	A533E	probably damaging	Het
Senp2	T	C	16: 22,009,735	S32P	probably damaging	Het
Sept11	T	A	5: 93,148,399	I52N	probably damaging	Het
Slc17a4	C	T	13: 23,901,769	R387H	probably benign	Het
Spdye4b	C	T	5: 143,192,329	T11I	probably benign	Het
Srrt	C	T	5: 137,302,125		probably null	Het
Sspo	T	A	6: 48,480,820	C3085S	probably damaging	Het
Stim1	C	T	7: 102,411,296	T182I	possibly damaging	Het
Thbs2	C	A	17: 14,687,851	V217L	probably benign	Het
Thpo	G	A	16: 20,728,748	R38C	probably damaging	Het
Tmem210	A	G	2: 25,288,432	E35G	possibly damaging	Het
Trim12c	T	A	7: 104,340,868		probably benign	Het
Tvp23b	A	G	11: 62,883,629	H33R	possibly damaging	Het
Usp14	A	G	18: 10,024,532		probably null	Het
Vmn2r73	A	G	7: 85,858,050	W685R	probably benign	Het
Zfp618	G	A	4: 63,133,564	A861T	probably benign	Het
Zfp715	A	G	7: 43,299,756	V260A	probably benign	Het

Other mutations in Clstn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00486:Clstn1	APN	4	149635243	missense	probably damaging	0.99
IGL00585:Clstn1	APN	4	149638312	missense	probably benign	0.05
IGL00911:Clstn1	APN	4	149643191	splice site	probably benign
IGL01394:Clstn1	APN	4	149634782	missense	possibly damaging	0.87
IGL02193:Clstn1	APN	4	149645352	missense	probably benign	0.03
IGL02406:Clstn1	APN	4	149627359	missense	probably damaging	1.00
IGL02501:Clstn1	APN	4	149631842	missense	probably damaging	1.00
IGL02641:Clstn1	APN	4	149629511	missense	probably null	1.00
R0012:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0020:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0021:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0026:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0031:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0038:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0062:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0064:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0193:Clstn1	UTSW	4	149634796	missense	probably damaging	0.96
R0279:Clstn1	UTSW	4	149643674	missense	probably damaging	1.00
R0394:Clstn1	UTSW	4	149644178	missense	probably benign	0.00
R0609:Clstn1	UTSW	4	149629300	splice site	probably null
R0685:Clstn1	UTSW	4	149646855	missense	probably benign	0.24
R0724:Clstn1	UTSW	4	149643624	missense	possibly damaging	0.84
R1016:Clstn1	UTSW	4	149646829	missense	probably benign	0.21
R1470:Clstn1	UTSW	4	149634722	missense	possibly damaging	0.94
R1470:Clstn1	UTSW	4	149634722	missense	possibly damaging	0.94
R1622:Clstn1	UTSW	4	149629407	missense	probably damaging	0.97
R1680:Clstn1	UTSW	4	149643726	missense	probably benign	0.02
R3803:Clstn1	UTSW	4	149635339	missense	probably damaging	0.99
R3836:Clstn1	UTSW	4	149638333	missense	probably damaging	1.00
R4923:Clstn1	UTSW	4	149645029	missense	probably benign	0.07
R5024:Clstn1	UTSW	4	149635294	missense	possibly damaging	0.91
R5919:Clstn1	UTSW	4	149635246	missense	probably damaging	1.00
R6269:Clstn1	UTSW	4	149644067	missense	probably benign	0.00
R6354:Clstn1	UTSW	4	149643216	missense	probably benign	0.05
R6382:Clstn1	UTSW	4	149626120	splice site	probably null
R6573:Clstn1	UTSW	4	149643689	missense	probably damaging	1.00
R7342:Clstn1	UTSW	4	149629430	missense	probably damaging	0.98
R7457:Clstn1	UTSW	4	149634916	missense	probably benign	0.03
R7571:Clstn1	UTSW	4	149646287	missense	probably benign	0.38
R7682:Clstn1	UTSW	4	149626101	missense	possibly damaging	0.72
R7738:Clstn1	UTSW	4	149635354	missense	probably damaging	1.00
R7803:Clstn1	UTSW	4	149631871	missense	probably damaging	1.00
R7904:Clstn1	UTSW	4	149614137	missense	probably benign	0.01
R7918:Clstn1	UTSW	4	149644051	missense	probably damaging	0.98
R8007:Clstn1	UTSW	4	149631848	missense	probably damaging	1.00
R8821:Clstn1	UTSW	4	149646323	missense	probably benign	0.00
R8831:Clstn1	UTSW	4	149646323	missense	probably benign	0.00
R9169:Clstn1	UTSW	4	149646865	missense	possibly damaging	0.68
R9173:Clstn1	UTSW	4	149626107	missense	probably benign	0.08
R9463:Clstn1	UTSW	4	149614107	missense	possibly damaging	0.92
R9491:Clstn1	UTSW	4	149647472	missense	probably damaging	1.00
R9615:Clstn1	UTSW	4	149638300	missense	probably damaging	1.00
X0020:Clstn1	UTSW	4	149635251	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGTCATTCCTACGCGTGAC -3'
(R):5'- AATCGATGACATGACTAGTGTTCC -3'

Sequencing Primer
(F):5'- ACGCGTGACTCATCTTCTGGG -3'
(R):5'- GACTAGTGTTCCCTAAAAGGCTACG -3'

Posted On

2015-04-06