Incidental Mutation 'R3838:Ntpcr'
ID276995
Institutional Source Beutler Lab
Gene Symbol Ntpcr
Ensembl Gene ENSMUSG00000031851
Gene Namenucleoside-triphosphatase, cancer-related
Synonyms
MMRRC Submission 040779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R3838 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location125729963-125748235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125737372 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 79 (V79M)
Ref Sequence ENSEMBL: ENSMUSP00000115996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034313] [ENSMUST00000065135] [ENSMUST00000143504] [ENSMUST00000152189]
Predicted Effect probably damaging
Transcript: ENSMUST00000034313
AA Change: V83M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034313
Gene: ENSMUSG00000031851
AA Change: V83M

DomainStartEndE-ValueType
AAA 1 170 2.61e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065135
AA Change: V83M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069384
Gene: ENSMUSG00000031851
AA Change: V83M

DomainStartEndE-ValueType
Pfam:NTPase_1 4 107 1.4e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138656
Predicted Effect probably benign
Transcript: ENSMUST00000143504
SMART Domains Protein: ENSMUSP00000121271
Gene: ENSMUSG00000031851

DomainStartEndE-ValueType
Pfam:NTPase_1 56 145 5.4e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151172
Predicted Effect probably damaging
Transcript: ENSMUST00000152189
AA Change: V79M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115996
Gene: ENSMUSG00000031851
AA Change: V79M

DomainStartEndE-ValueType
Pfam:NTPase_1 6 178 3.2e-63 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a non-specific nucleoside triphosphatase that is slow-acting in vitro. This gene is overexpressed in many tumor tissues, and while it is not essential for the cell, overexpression is cytotoxic. However, the cytotoxicity is not related to its triphosphatase activity. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,521 T41A probably benign Het
4930486L24Rik A G 13: 60,845,227 Y213H probably damaging Het
Alg8 C T 7: 97,388,545 H379Y probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Arid4a A G 12: 71,075,785 E980G possibly damaging Het
Aspm C T 1: 139,478,054 H1560Y probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
Bud13 A C 9: 46,290,192 Q387P possibly damaging Het
Champ1 A G 8: 13,879,939 Y699C probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Col2a1 T C 15: 97,988,976 D345G unknown Het
Col2a1 A T 15: 98,000,581 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Dnajb2 G A 1: 75,241,480 probably null Het
Dock4 G T 12: 40,794,624 probably null Het
Epx A T 11: 87,874,830 L101Q probably damaging Het
F13a1 A T 13: 37,047,424 N21K probably damaging Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a T C 14: 34,245,368 D77G probably benign Het
Foxj3 T A 4: 119,616,624 H215Q possibly damaging Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Ighmbp2 T C 19: 3,271,658 Y367C probably benign Het
Lrrc14b A G 13: 74,363,545 C139R possibly damaging Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msn C A X: 96,160,199 Q303K probably damaging Het
Myh7b A G 2: 155,632,989 K1816E probably damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nme2 T A 11: 93,949,977 E252D probably benign Het
Ogdh C T 11: 6,338,627 R235* probably null Het
Olfr1490 A G 19: 13,654,957 D176G probably benign Het
Olfr825 C A 10: 130,162,406 E307* probably null Het
Olfr959 A G 9: 39,572,971 V96A probably benign Het
Pcdh20 T C 14: 88,468,463 N467S probably benign Het
Pkhd1 G A 1: 20,534,629 T1154I possibly damaging Het
Polq G T 16: 37,078,349 R2157I probably damaging Het
Reep6 C A 10: 80,335,889 A533E probably damaging Het
Senp2 T C 16: 22,009,735 S32P probably damaging Het
Sept11 T A 5: 93,148,399 I52N probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Spdye4b C T 5: 143,192,329 T11I probably benign Het
Srrt C T 5: 137,302,125 probably null Het
Sspo T A 6: 48,480,820 C3085S probably damaging Het
Stim1 C T 7: 102,411,296 T182I possibly damaging Het
Thbs2 C A 17: 14,687,851 V217L probably benign Het
Thpo G A 16: 20,728,748 R38C probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Trim12c T A 7: 104,340,868 probably benign Het
Tvp23b A G 11: 62,883,629 H33R possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r73 A G 7: 85,858,050 W685R probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp715 A G 7: 43,299,756 V260A probably benign Het
Other mutations in Ntpcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Ntpcr APN 8 125747762 missense probably damaging 0.98
IGL01582:Ntpcr APN 8 125745242 missense probably benign 0.11
IGL01862:Ntpcr APN 8 125736098 missense probably benign 0.14
IGL02045:Ntpcr APN 8 125745452 splice site probably benign
IGL02077:Ntpcr APN 8 125737368 nonsense probably null
R0491:Ntpcr UTSW 8 125737354 nonsense probably null
R0988:Ntpcr UTSW 8 125737431 splice site probably benign
R1781:Ntpcr UTSW 8 125745402 missense probably damaging 1.00
R2412:Ntpcr UTSW 8 125745405 missense probably damaging 1.00
R4453:Ntpcr UTSW 8 125736190 missense probably benign 0.14
R6126:Ntpcr UTSW 8 125735887 critical splice donor site probably null
R6440:Ntpcr UTSW 8 125745242 missense probably damaging 0.97
R6463:Ntpcr UTSW 8 125736104 missense probably benign 0.02
R7102:Ntpcr UTSW 8 125730055 missense unknown
R7910:Ntpcr UTSW 8 125747744 missense probably benign
R8230:Ntpcr UTSW 8 125737420 critical splice donor site probably null
X0024:Ntpcr UTSW 8 125745426 missense probably damaging 0.99
X0025:Ntpcr UTSW 8 125745315 missense probably damaging 1.00
Z1177:Ntpcr UTSW 8 125745284 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AACCACAGTGAGTCCAACCTTG -3'
(R):5'- ATTGGACTGCCTATCCTTAGC -3'

Sequencing Primer
(F):5'- AGTGAGTCCAACCTTGTACACTC -3'
(R):5'- CCTTAGCAAGGTTCAGTGGC -3'
Posted On2015-04-06