Incidental Mutation 'R3838:Nap1l1'
ID277004
Institutional Source Beutler Lab
Gene Symbol Nap1l1
Ensembl Gene ENSMUSG00000058799
Gene Namenucleosome assembly protein 1-like 1
SynonymsD10Ertd68e
MMRRC Submission 040779-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R3838 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location111473223-111498150 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 111495322 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065917] [ENSMUST00000171797] [ENSMUST00000217908] [ENSMUST00000218828] [ENSMUST00000219143] [ENSMUST00000219961]
Predicted Effect probably null
Transcript: ENSMUST00000065917
SMART Domains Protein: ENSMUSP00000070068
Gene: ENSMUSG00000058799

DomainStartEndE-ValueType
coiled coil region 6 31 N/A INTRINSIC
Pfam:NAP 75 346 1.5e-96 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171797
SMART Domains Protein: ENSMUSP00000126850
Gene: ENSMUSG00000058799

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
coiled coil region 33 58 N/A INTRINSIC
Pfam:NAP 103 372 9.6e-110 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217908
Predicted Effect probably null
Transcript: ENSMUST00000218828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218982
Predicted Effect probably benign
Transcript: ENSMUST00000219143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219718
Predicted Effect probably benign
Transcript: ENSMUST00000219961
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleosome assembly protein (NAP) family. This protein participates in DNA replication and may play a role in modulating chromatin formation and contribute to the regulation of cell proliferation. Alternative splicing results in multiple transcript variants encoding different isoforms; however, not all have been fully described. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,521 T41A probably benign Het
4930486L24Rik A G 13: 60,845,227 Y213H probably damaging Het
Alg8 C T 7: 97,388,545 H379Y probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Arid4a A G 12: 71,075,785 E980G possibly damaging Het
Aspm C T 1: 139,478,054 H1560Y probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
Bud13 A C 9: 46,290,192 Q387P possibly damaging Het
Champ1 A G 8: 13,879,939 Y699C probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Col2a1 T C 15: 97,988,976 D345G unknown Het
Col2a1 A T 15: 98,000,581 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Dnajb2 G A 1: 75,241,480 probably null Het
Dock4 G T 12: 40,794,624 probably null Het
Epx A T 11: 87,874,830 L101Q probably damaging Het
F13a1 A T 13: 37,047,424 N21K probably damaging Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a T C 14: 34,245,368 D77G probably benign Het
Foxj3 T A 4: 119,616,624 H215Q possibly damaging Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Ighmbp2 T C 19: 3,271,658 Y367C probably benign Het
Lrrc14b A G 13: 74,363,545 C139R possibly damaging Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msn C A X: 96,160,199 Q303K probably damaging Het
Myh7b A G 2: 155,632,989 K1816E probably damaging Het
Nme2 T A 11: 93,949,977 E252D probably benign Het
Ntpcr G A 8: 125,737,372 V79M probably damaging Het
Ogdh C T 11: 6,338,627 R235* probably null Het
Olfr1490 A G 19: 13,654,957 D176G probably benign Het
Olfr825 C A 10: 130,162,406 E307* probably null Het
Olfr959 A G 9: 39,572,971 V96A probably benign Het
Pcdh20 T C 14: 88,468,463 N467S probably benign Het
Pkhd1 G A 1: 20,534,629 T1154I possibly damaging Het
Polq G T 16: 37,078,349 R2157I probably damaging Het
Reep6 C A 10: 80,335,889 A533E probably damaging Het
Senp2 T C 16: 22,009,735 S32P probably damaging Het
Sept11 T A 5: 93,148,399 I52N probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Spdye4b C T 5: 143,192,329 T11I probably benign Het
Srrt C T 5: 137,302,125 probably null Het
Sspo T A 6: 48,480,820 C3085S probably damaging Het
Stim1 C T 7: 102,411,296 T182I possibly damaging Het
Thbs2 C A 17: 14,687,851 V217L probably benign Het
Thpo G A 16: 20,728,748 R38C probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Trim12c T A 7: 104,340,868 probably benign Het
Tvp23b A G 11: 62,883,629 H33R possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r73 A G 7: 85,858,050 W685R probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp715 A G 7: 43,299,756 V260A probably benign Het
Other mutations in Nap1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Nap1l1 APN 10 111486675 missense probably damaging 0.98
IGL01453:Nap1l1 APN 10 111492978 missense probably benign 0.09
IGL01734:Nap1l1 APN 10 111492899 missense probably benign 0.26
IGL01843:Nap1l1 APN 10 111492911 missense possibly damaging 0.93
PIT1430001:Nap1l1 UTSW 10 111486736 missense probably damaging 1.00
PIT4131001:Nap1l1 UTSW 10 111486722 missense probably null
R0020:Nap1l1 UTSW 10 111491023 missense probably benign 0.01
R0020:Nap1l1 UTSW 10 111491023 missense probably benign 0.01
R0131:Nap1l1 UTSW 10 111485509 missense probably benign 0.17
R0131:Nap1l1 UTSW 10 111485509 missense probably benign 0.17
R0132:Nap1l1 UTSW 10 111485509 missense probably benign 0.17
R0601:Nap1l1 UTSW 10 111490363 splice site probably benign
R1576:Nap1l1 UTSW 10 111494820 missense probably damaging 1.00
R1619:Nap1l1 UTSW 10 111493379 missense possibly damaging 0.77
R1969:Nap1l1 UTSW 10 111491053 missense probably benign 0.03
R2071:Nap1l1 UTSW 10 111492900 missense possibly damaging 0.46
R2383:Nap1l1 UTSW 10 111493411 missense probably damaging 1.00
R3836:Nap1l1 UTSW 10 111495322 splice site probably null
R3837:Nap1l1 UTSW 10 111495322 splice site probably null
R3839:Nap1l1 UTSW 10 111495322 splice site probably null
R4084:Nap1l1 UTSW 10 111490077 missense possibly damaging 0.92
R4609:Nap1l1 UTSW 10 111492880 nonsense probably null
R4985:Nap1l1 UTSW 10 111490083 missense probably benign 0.01
R5906:Nap1l1 UTSW 10 111491030 nonsense probably null
R5982:Nap1l1 UTSW 10 111495368 missense possibly damaging 0.71
R6522:Nap1l1 UTSW 10 111494223 missense probably damaging 0.99
R6868:Nap1l1 UTSW 10 111494808 missense probably damaging 1.00
R7134:Nap1l1 UTSW 10 111494794 critical splice acceptor site probably null
R7202:Nap1l1 UTSW 10 111491103 missense probably damaging 1.00
R7789:Nap1l1 UTSW 10 111490456 missense probably benign 0.01
R7950:Nap1l1 UTSW 10 111492908 missense probably damaging 1.00
R8404:Nap1l1 UTSW 10 111481301 start codon destroyed probably null 0.53
R8502:Nap1l1 UTSW 10 111481301 start codon destroyed probably null 0.53
Predicted Primers PCR Primer
(F):5'- ACGTTGGCTGCAGTAAATCTTTTC -3'
(R):5'- CCTTTGTGTGGAAAACAATCTAAGC -3'

Sequencing Primer
(F):5'- AAAGCTGTCTGGATGTCTCAAG -3'
(R):5'- TGTGTGGAAAACAATCTAAGCAACAG -3'
Posted On2015-04-06