Incidental Mutation 'R3838:Epx'
ID277008
Institutional Source Beutler Lab
Gene Symbol Epx
Ensembl Gene ENSMUSG00000052234
Gene Nameeosinophil peroxidase
SynonymsEPO
MMRRC Submission 040779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3838 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location87864000-87875536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87874830 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 101 (L101Q)
Ref Sequence ENSEMBL: ENSMUSP00000050497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049768]
Predicted Effect probably damaging
Transcript: ENSMUST00000049768
AA Change: L101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050497
Gene: ENSMUSG00000052234
AA Change: L101Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:An_peroxidase 146 690 8.3e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125590
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peroxidase superfamily of enzymes that is produced by eosinophils and plays a critical role in eliminating tissue-invasive parasites. The encoded preproprotein undergoes proteolytic processing to generate a heterodimeric enzyme that forms a predominant component of the intracellular granules of eosinophils. Mice lacking the encoded protein exhibit resistance to ulcerative colitis induced by dextran sulfate. [provided by RefSeq, Jul 2016]
PHENOTYPE: Targeted deletion of this gene results in ultrastructural changes of the eosinophil secondary granule but does not significantly alter the course of inflammation or development of allergic pulmonary pathologies in an ovalbumin-challenge model of pulmonary inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,521 T41A probably benign Het
4930486L24Rik A G 13: 60,845,227 Y213H probably damaging Het
Alg8 C T 7: 97,388,545 H379Y probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Arid4a A G 12: 71,075,785 E980G possibly damaging Het
Aspm C T 1: 139,478,054 H1560Y probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
Bud13 A C 9: 46,290,192 Q387P possibly damaging Het
Champ1 A G 8: 13,879,939 Y699C probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Col2a1 T C 15: 97,988,976 D345G unknown Het
Col2a1 A T 15: 98,000,581 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Dnajb2 G A 1: 75,241,480 probably null Het
Dock4 G T 12: 40,794,624 probably null Het
F13a1 A T 13: 37,047,424 N21K probably damaging Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a T C 14: 34,245,368 D77G probably benign Het
Foxj3 T A 4: 119,616,624 H215Q possibly damaging Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Ighmbp2 T C 19: 3,271,658 Y367C probably benign Het
Lrrc14b A G 13: 74,363,545 C139R possibly damaging Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msn C A X: 96,160,199 Q303K probably damaging Het
Myh7b A G 2: 155,632,989 K1816E probably damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nme2 T A 11: 93,949,977 E252D probably benign Het
Ntpcr G A 8: 125,737,372 V79M probably damaging Het
Ogdh C T 11: 6,338,627 R235* probably null Het
Olfr1490 A G 19: 13,654,957 D176G probably benign Het
Olfr825 C A 10: 130,162,406 E307* probably null Het
Olfr959 A G 9: 39,572,971 V96A probably benign Het
Pcdh20 T C 14: 88,468,463 N467S probably benign Het
Pkhd1 G A 1: 20,534,629 T1154I possibly damaging Het
Polq G T 16: 37,078,349 R2157I probably damaging Het
Reep6 C A 10: 80,335,889 A533E probably damaging Het
Senp2 T C 16: 22,009,735 S32P probably damaging Het
Sept11 T A 5: 93,148,399 I52N probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Spdye4b C T 5: 143,192,329 T11I probably benign Het
Srrt C T 5: 137,302,125 probably null Het
Sspo T A 6: 48,480,820 C3085S probably damaging Het
Stim1 C T 7: 102,411,296 T182I possibly damaging Het
Thbs2 C A 17: 14,687,851 V217L probably benign Het
Thpo G A 16: 20,728,748 R38C probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Trim12c T A 7: 104,340,868 probably benign Het
Tvp23b A G 11: 62,883,629 H33R possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r73 A G 7: 85,858,050 W685R probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp715 A G 7: 43,299,756 V260A probably benign Het
Other mutations in Epx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Epx APN 11 87869925 missense probably damaging 1.00
IGL01723:Epx APN 11 87869402 missense probably damaging 1.00
IGL02096:Epx APN 11 87869468 missense probably damaging 1.00
IGL02423:Epx APN 11 87871318 missense possibly damaging 0.85
K7371:Epx UTSW 11 87864884 missense probably damaging 1.00
R1018:Epx UTSW 11 87869303 missense probably benign 0.05
R1607:Epx UTSW 11 87868712 missense probably damaging 1.00
R2017:Epx UTSW 11 87874337 missense probably damaging 1.00
R2030:Epx UTSW 11 87864824 missense probably damaging 1.00
R4417:Epx UTSW 11 87869430 nonsense probably null
R5083:Epx UTSW 11 87872680 missense probably damaging 0.99
R5712:Epx UTSW 11 87874853 nonsense probably null
R5935:Epx UTSW 11 87865492 missense probably damaging 1.00
R6830:Epx UTSW 11 87868626 missense probably damaging 1.00
R6857:Epx UTSW 11 87869955 nonsense probably null
R6984:Epx UTSW 11 87868598 missense probably damaging 1.00
R7031:Epx UTSW 11 87875523 start gained probably benign
R7652:Epx UTSW 11 87875334 critical splice donor site probably null
R7667:Epx UTSW 11 87874311 missense probably damaging 0.98
R7969:Epx UTSW 11 87872721 missense probably benign 0.01
R8313:Epx UTSW 11 87872731 missense possibly damaging 0.71
X0065:Epx UTSW 11 87865475 missense probably benign 0.03
Z1177:Epx UTSW 11 87869261 missense probably damaging 1.00
Z1177:Epx UTSW 11 87869894 missense possibly damaging 0.56
Z1177:Epx UTSW 11 87872767 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCTCTTACCTGGGCTGTTCAG -3'
(R):5'- AAGAACTATGGGTCTCCCTGC -3'

Sequencing Primer
(F):5'- GGGCTGTTCAGTTCCACC -3'
(R):5'- GAGAATTTATGGTTAGCCTGCACCC -3'
Posted On2015-04-06