Mutagenetix > Incidental Mutations

Incidental Mutation 'R3838:Mrc2'

277010

Institutional Source

Beutler Lab

Gene Symbol

Mrc2

Ensembl Gene

ENSMUSG00000020695

Gene Name

mannose receptor, C type 2

Synonyms

Endo180, uPARAP, novel lectin

MMRRC Submission

040779-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3838 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105292643-105351139 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 105348431 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000097909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]

Predicted Effect

probably benign
Transcript: ENSMUST00000021038

SMART Domains

Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000100335

SMART Domains

Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART
CLECT	971	1107	3.91e-36	SMART
CLECT	1124	1243	1.04e-17	SMART
CLECT	1259	1392	9.08e-23	SMART
transmembrane domain	1412	1434	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.8%
20x: 96.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700042G07Rik	A	G	4: 116,173,521	T41A	probably benign	Het
4930486L24Rik	A	G	13: 60,845,227	Y213H	probably damaging	Het
Alg8	C	T	7: 97,388,545	H379Y	probably damaging	Het
Arhgef25	T	C	10: 127,189,736	T12A	probably benign	Het
Arid4a	A	G	12: 71,075,785	E980G	possibly damaging	Het
Aspm	C	T	1: 139,478,054	H1560Y	probably benign	Het
Atg10	A	T	13: 90,937,380	I150K	probably damaging	Het
Bud13	A	C	9: 46,290,192	Q387P	possibly damaging	Het
Champ1	A	G	8: 13,879,939	Y699C	probably damaging	Het
Clstn1	A	G	4: 149,638,333	E476G	probably damaging	Het
Col2a1	T	C	15: 97,988,976	D345G	unknown	Het
Col2a1	A	T	15: 98,000,581		probably benign	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Dnajb2	G	A	1: 75,241,480		probably null	Het
Dock4	G	T	12: 40,794,624		probably null	Het
Epx	A	T	11: 87,874,830	L101Q	probably damaging	Het
F13a1	A	T	13: 37,047,424	N21K	probably damaging	Het
Fam13c	C	T	10: 70,542,648	S336L	probably damaging	Het
Fam35a	T	C	14: 34,245,368	D77G	probably benign	Het
Foxj3	T	A	4: 119,616,624	H215Q	possibly damaging	Het
Gcnt4	A	T	13: 96,947,014	R273*	probably null	Het
Gpam	T	C	19: 55,080,458	N450S	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hmcn2	T	C	2: 31,413,407	L3020P	probably damaging	Het
Hmgcr	A	G	13: 96,659,089	I324T	probably benign	Het
Ighmbp2	T	C	19: 3,271,658	Y367C	probably benign	Het
Lrrc14b	A	G	13: 74,363,545	C139R	possibly damaging	Het
Lsamp	A	T	16: 42,134,312	E174V	possibly damaging	Het
Mid1ip1	T	C	X: 10,718,381	V51A	possibly damaging	Het
Msn	C	A	X: 96,160,199	Q303K	probably damaging	Het
Myh7b	A	G	2: 155,632,989	K1816E	probably damaging	Het
Nap1l1	T	A	10: 111,495,322		probably null	Het
Nme2	T	A	11: 93,949,977	E252D	probably benign	Het
Ntpcr	G	A	8: 125,737,372	V79M	probably damaging	Het
Ogdh	C	T	11: 6,338,627	R235*	probably null	Het
Olfr1490	A	G	19: 13,654,957	D176G	probably benign	Het
Olfr825	C	A	10: 130,162,406	E307*	probably null	Het
Olfr959	A	G	9: 39,572,971	V96A	probably benign	Het
Pcdh20	T	C	14: 88,468,463	N467S	probably benign	Het
Pkhd1	G	A	1: 20,534,629	T1154I	possibly damaging	Het
Polq	G	T	16: 37,078,349	R2157I	probably damaging	Het
Reep6	C	A	10: 80,335,889	A533E	probably damaging	Het
Senp2	T	C	16: 22,009,735	S32P	probably damaging	Het
Sept11	T	A	5: 93,148,399	I52N	probably damaging	Het
Slc17a4	C	T	13: 23,901,769	R387H	probably benign	Het
Spdye4b	C	T	5: 143,192,329	T11I	probably benign	Het
Srrt	C	T	5: 137,302,125		probably null	Het
Sspo	T	A	6: 48,480,820	C3085S	probably damaging	Het
Stim1	C	T	7: 102,411,296	T182I	possibly damaging	Het
Thbs2	C	A	17: 14,687,851	V217L	probably benign	Het
Thpo	G	A	16: 20,728,748	R38C	probably damaging	Het
Tmem210	A	G	2: 25,288,432	E35G	possibly damaging	Het
Trim12c	T	A	7: 104,340,868		probably benign	Het
Tvp23b	A	G	11: 62,883,629	H33R	possibly damaging	Het
Usp14	A	G	18: 10,024,532		probably null	Het
Vmn2r73	A	G	7: 85,858,050	W685R	probably benign	Het
Zfp618	G	A	4: 63,133,564	A861T	probably benign	Het
Zfp715	A	G	7: 43,299,756	V260A	probably benign	Het

Other mutations in Mrc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Mrc2	APN	11	105328741	missense	probably damaging	0.96
IGL01374:Mrc2	APN	11	105347643	nonsense	probably null
IGL01751:Mrc2	APN	11	105325734	missense	probably benign	0.00
IGL01780:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL01835:Mrc2	APN	11	105336677	missense	probably damaging	1.00
IGL02350:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02357:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02829:Mrc2	APN	11	105336707	missense	possibly damaging	0.85
IGL02863:Mrc2	APN	11	105333620	splice site	probably benign
IGL02940:Mrc2	APN	11	105341171	missense	probably damaging	1.00
IGL02988:Mrc2	UTSW	11	105325571	missense	probably benign	0.04
R0254:Mrc2	UTSW	11	105347866	missense	probably benign	0.00
R0634:Mrc2	UTSW	11	105347692	missense	probably benign	0.01
R1102:Mrc2	UTSW	11	105340821	missense	probably benign
R1233:Mrc2	UTSW	11	105348415	missense	probably damaging	1.00
R1244:Mrc2	UTSW	11	105348431	splice site	probably null
R1458:Mrc2	UTSW	11	105337772	missense	probably benign	0.01
R1500:Mrc2	UTSW	11	105347725	missense	probably damaging	1.00
R1573:Mrc2	UTSW	11	105336656	missense	probably damaging	1.00
R1770:Mrc2	UTSW	11	105338793	missense	probably damaging	0.99
R1842:Mrc2	UTSW	11	105337720	missense	probably damaging	0.98
R2156:Mrc2	UTSW	11	105347856	splice site	probably null
R2165:Mrc2	UTSW	11	105348431	splice site	probably null
R2265:Mrc2	UTSW	11	105348431	splice site	probably null
R2266:Mrc2	UTSW	11	105348431	splice site	probably null
R2267:Mrc2	UTSW	11	105348431	splice site	probably null
R2268:Mrc2	UTSW	11	105348431	splice site	probably null
R2269:Mrc2	UTSW	11	105348431	splice site	probably null
R2270:Mrc2	UTSW	11	105348431	splice site	probably null
R2271:Mrc2	UTSW	11	105348431	splice site	probably null
R2272:Mrc2	UTSW	11	105348431	splice site	probably null
R2296:Mrc2	UTSW	11	105348431	splice site	probably null
R2298:Mrc2	UTSW	11	105348431	splice site	probably null
R2300:Mrc2	UTSW	11	105348431	splice site	probably null
R2326:Mrc2	UTSW	11	105348431	splice site	probably null
R2518:Mrc2	UTSW	11	105348431	splice site	probably null
R2519:Mrc2	UTSW	11	105348431	splice site	probably null
R2520:Mrc2	UTSW	11	105348431	splice site	probably null
R2895:Mrc2	UTSW	11	105348431	splice site	probably null
R3029:Mrc2	UTSW	11	105348431	splice site	probably null
R3030:Mrc2	UTSW	11	105348431	splice site	probably null
R3079:Mrc2	UTSW	11	105336713	missense	probably damaging	0.97
R3122:Mrc2	UTSW	11	105348431	splice site	probably null
R3149:Mrc2	UTSW	11	105348431	splice site	probably null
R3150:Mrc2	UTSW	11	105348431	splice site	probably null
R3420:Mrc2	UTSW	11	105348431	splice site	probably null
R3422:Mrc2	UTSW	11	105348431	splice site	probably null
R3441:Mrc2	UTSW	11	105347716	missense	possibly damaging	0.87
R3726:Mrc2	UTSW	11	105348431	splice site	probably null
R3731:Mrc2	UTSW	11	105348431	splice site	probably null
R3800:Mrc2	UTSW	11	105348431	splice site	probably null
R3820:Mrc2	UTSW	11	105348431	splice site	probably null
R3821:Mrc2	UTSW	11	105348431	splice site	probably null
R3837:Mrc2	UTSW	11	105348431	splice site	probably null
R3849:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3850:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3914:Mrc2	UTSW	11	105347232	splice site	probably benign
R3932:Mrc2	UTSW	11	105348431	splice site	probably null
R3933:Mrc2	UTSW	11	105348431	splice site	probably null
R3971:Mrc2	UTSW	11	105328031	missense	possibly damaging	0.65
R4105:Mrc2	UTSW	11	105348431	splice site	probably null
R4107:Mrc2	UTSW	11	105348431	splice site	probably null
R4113:Mrc2	UTSW	11	105348431	splice site	probably null
R4274:Mrc2	UTSW	11	105348431	splice site	probably null
R4399:Mrc2	UTSW	11	105336658	nonsense	probably null
R4477:Mrc2	UTSW	11	105348431	splice site	probably null
R4478:Mrc2	UTSW	11	105348431	splice site	probably null
R4493:Mrc2	UTSW	11	105348431	splice site	probably null
R4494:Mrc2	UTSW	11	105348431	splice site	probably null
R4495:Mrc2	UTSW	11	105348431	splice site	probably null
R4547:Mrc2	UTSW	11	105336641	missense	probably benign	0.04
R4600:Mrc2	UTSW	11	105348431	splice site	probably null
R4601:Mrc2	UTSW	11	105348431	splice site	probably null
R4602:Mrc2	UTSW	11	105348431	splice site	probably null
R4603:Mrc2	UTSW	11	105348431	splice site	probably null
R4610:Mrc2	UTSW	11	105348431	splice site	probably null
R4611:Mrc2	UTSW	11	105348431	splice site	probably null
R4637:Mrc2	UTSW	11	105348431	splice site	probably null
R4672:Mrc2	UTSW	11	105343097	missense	probably benign	0.22
R4674:Mrc2	UTSW	11	105348431	splice site	probably null
R4675:Mrc2	UTSW	11	105348431	splice site	probably null
R4693:Mrc2	UTSW	11	105343702	missense	probably benign	0.00
R4706:Mrc2	UTSW	11	105348431	splice site	probably null
R4707:Mrc2	UTSW	11	105348431	splice site	probably null
R4791:Mrc2	UTSW	11	105348431	splice site	probably null
R4792:Mrc2	UTSW	11	105348431	splice site	probably null
R4888:Mrc2	UTSW	11	105341208	missense	probably damaging	0.99
R5523:Mrc2	UTSW	11	105343582	missense	probably benign
R5600:Mrc2	UTSW	11	105333666	missense	probably damaging	1.00
R5634:Mrc2	UTSW	11	105336214	nonsense	probably null
R5692:Mrc2	UTSW	11	105336642	missense	probably damaging	0.99
R5706:Mrc2	UTSW	11	105332343	missense	probably damaging	1.00
R5775:Mrc2	UTSW	11	105337813	missense	probably benign	0.00
R6140:Mrc2	UTSW	11	105346789	missense	probably benign
R6146:Mrc2	UTSW	11	105325644	missense	probably damaging	0.98
R6225:Mrc2	UTSW	11	105346820	missense	probably benign	0.01
R6437:Mrc2	UTSW	11	105349843	missense	probably damaging	1.00
R6618:Mrc2	UTSW	11	105349882	missense	probably damaging	1.00
R6675:Mrc2	UTSW	11	105343080	splice site	probably null
R6680:Mrc2	UTSW	11	105325753	missense	probably damaging	0.98
R6868:Mrc2	UTSW	11	105328418	missense	probably damaging	1.00
R6979:Mrc2	UTSW	11	105348635	missense	probably damaging	0.96
R7038:Mrc2	UTSW	11	105332236	missense	possibly damaging	0.46
R7303:Mrc2	UTSW	11	105325803	missense	probably damaging	1.00
R7320:Mrc2	UTSW	11	105329235	missense	possibly damaging	0.92
R7537:Mrc2	UTSW	11	105292797	missense	probably benign
R7640:Mrc2	UTSW	11	105332295	missense	possibly damaging	0.48
R7709:Mrc2	UTSW	11	105346459	missense	probably benign	0.10
T0970:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0004:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0062:Mrc2	UTSW	11	105347475	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATCTTGCACTTGAGCTGCCAG -3'
(R):5'- TGTGGAAGGAACCCATTGG -3'

Sequencing Primer
(F):5'- GGTCTATCACCATAAGGAGAATCTGC -3'
(R):5'- CCATTGGGAAGGTGTGGGAATG -3'

Posted On

2015-04-06