Incidental Mutation 'R3838:Hmgcr'
ID277018
Institutional Source Beutler Lab
Gene Symbol Hmgcr
Ensembl Gene ENSMUSG00000021670
Gene Name3-hydroxy-3-methylglutaryl-Coenzyme A reductase
SynonymsHMG-CoAR, 3-hydroxy-3-methylglutaryl-CoA reductase, Red
MMRRC Submission 040779-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3838 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location96648967-96670936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96659089 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 324 (I324T)
Ref Sequence ENSEMBL: ENSMUSP00000128939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022176] [ENSMUST00000168855] [ENSMUST00000169196] [ENSMUST00000169202] [ENSMUST00000170287]
Predicted Effect probably benign
Transcript: ENSMUST00000022176
AA Change: I324T

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022176
Gene: ENSMUSG00000021670
AA Change: I324T

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Patched 56 342 2.7e-11 PFAM
Pfam:Sterol-sensing 85 234 3.4e-20 PFAM
Pfam:HMG-CoA_red 490 870 2.2e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163201
Predicted Effect probably benign
Transcript: ENSMUST00000168855
Predicted Effect probably benign
Transcript: ENSMUST00000169196
SMART Domains Protein: ENSMUSP00000132749
Gene: ENSMUSG00000021670

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Pfam:Sterol-sensing 85 210 4.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169202
SMART Domains Protein: ENSMUSP00000132155
Gene: ENSMUSG00000021670

DomainStartEndE-ValueType
Pfam:HMG-CoA_red 35 219 8.8e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170287
AA Change: I324T

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128939
Gene: ENSMUSG00000021670
AA Change: I324T

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Patched 56 347 1.4e-11 PFAM
Pfam:Sterol-sensing 85 234 7.4e-20 PFAM
Pfam:HMG-CoA_red 488 819 1.3e-148 PFAM
Meta Mutation Damage Score 0.3729 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HMG-CoA reductase is the rate-limiting enzyme for cholesterol synthesis and is regulated via a negative feedback mechanism mediated by sterols and non-sterol metabolites derived from mevalonate, the product of the reaction catalyzed by reductase. Normally in mammalian cells this enzyme is suppressed by cholesterol derived from the internalization and degradation of low density lipoprotein (LDL) via the LDL receptor. Competitive inhibitors of the reductase induce the expression of LDL receptors in the liver, which in turn increases the catabolism of plasma LDL and lowers the plasma concentration of cholesterol, an important determinant of atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Inactivation of both copies of this gene results in early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,521 T41A probably benign Het
4930486L24Rik A G 13: 60,845,227 Y213H probably damaging Het
Alg8 C T 7: 97,388,545 H379Y probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Arid4a A G 12: 71,075,785 E980G possibly damaging Het
Aspm C T 1: 139,478,054 H1560Y probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
Bud13 A C 9: 46,290,192 Q387P possibly damaging Het
Champ1 A G 8: 13,879,939 Y699C probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Col2a1 T C 15: 97,988,976 D345G unknown Het
Col2a1 A T 15: 98,000,581 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Dnajb2 G A 1: 75,241,480 probably null Het
Dock4 G T 12: 40,794,624 probably null Het
Epx A T 11: 87,874,830 L101Q probably damaging Het
F13a1 A T 13: 37,047,424 N21K probably damaging Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a T C 14: 34,245,368 D77G probably benign Het
Foxj3 T A 4: 119,616,624 H215Q possibly damaging Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Ighmbp2 T C 19: 3,271,658 Y367C probably benign Het
Lrrc14b A G 13: 74,363,545 C139R possibly damaging Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msn C A X: 96,160,199 Q303K probably damaging Het
Myh7b A G 2: 155,632,989 K1816E probably damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nme2 T A 11: 93,949,977 E252D probably benign Het
Ntpcr G A 8: 125,737,372 V79M probably damaging Het
Ogdh C T 11: 6,338,627 R235* probably null Het
Olfr1490 A G 19: 13,654,957 D176G probably benign Het
Olfr825 C A 10: 130,162,406 E307* probably null Het
Olfr959 A G 9: 39,572,971 V96A probably benign Het
Pcdh20 T C 14: 88,468,463 N467S probably benign Het
Pkhd1 G A 1: 20,534,629 T1154I possibly damaging Het
Polq G T 16: 37,078,349 R2157I probably damaging Het
Reep6 C A 10: 80,335,889 A533E probably damaging Het
Senp2 T C 16: 22,009,735 S32P probably damaging Het
Sept11 T A 5: 93,148,399 I52N probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Spdye4b C T 5: 143,192,329 T11I probably benign Het
Srrt C T 5: 137,302,125 probably null Het
Sspo T A 6: 48,480,820 C3085S probably damaging Het
Stim1 C T 7: 102,411,296 T182I possibly damaging Het
Thbs2 C A 17: 14,687,851 V217L probably benign Het
Thpo G A 16: 20,728,748 R38C probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Trim12c T A 7: 104,340,868 probably benign Het
Tvp23b A G 11: 62,883,629 H33R possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r73 A G 7: 85,858,050 W685R probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp715 A G 7: 43,299,756 V260A probably benign Het
Other mutations in Hmgcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Hmgcr APN 13 96659278 missense probably benign
IGL01369:Hmgcr APN 13 96666522 missense probably null 1.00
IGL01575:Hmgcr APN 13 96656595 missense possibly damaging 0.56
IGL02183:Hmgcr APN 13 96663127 missense probably damaging 1.00
IGL02515:Hmgcr APN 13 96666512 splice site probably benign
IGL02716:Hmgcr APN 13 96660012 critical splice acceptor site probably null
IGL03278:Hmgcr APN 13 96656762 splice site probably benign
IGL03367:Hmgcr APN 13 96665853 missense probably damaging 0.98
PIT4131001:Hmgcr UTSW 13 96659054 missense probably damaging 1.00
PIT4504001:Hmgcr UTSW 13 96663097 missense possibly damaging 0.95
R0003:Hmgcr UTSW 13 96652145 missense probably damaging 1.00
R0017:Hmgcr UTSW 13 96652089 splice site probably benign
R0017:Hmgcr UTSW 13 96652089 splice site probably benign
R0217:Hmgcr UTSW 13 96651980 missense probably damaging 1.00
R0511:Hmgcr UTSW 13 96660143 unclassified probably null
R0707:Hmgcr UTSW 13 96650643 unclassified probably benign
R1301:Hmgcr UTSW 13 96659020 missense probably damaging 0.97
R2203:Hmgcr UTSW 13 96656633 missense probably damaging 1.00
R2204:Hmgcr UTSW 13 96656633 missense probably damaging 1.00
R2433:Hmgcr UTSW 13 96665885 missense probably damaging 1.00
R2938:Hmgcr UTSW 13 96663068 missense probably damaging 0.99
R3159:Hmgcr UTSW 13 96665847 missense probably damaging 1.00
R3737:Hmgcr UTSW 13 96651063 missense probably damaging 1.00
R3752:Hmgcr UTSW 13 96663116 missense probably damaging 1.00
R3837:Hmgcr UTSW 13 96659089 missense probably benign 0.19
R3839:Hmgcr UTSW 13 96659089 missense probably benign 0.19
R4034:Hmgcr UTSW 13 96651063 missense probably damaging 1.00
R4035:Hmgcr UTSW 13 96651063 missense probably damaging 1.00
R4210:Hmgcr UTSW 13 96660221 missense probably damaging 1.00
R4783:Hmgcr UTSW 13 96666193 missense probably damaging 1.00
R4820:Hmgcr UTSW 13 96660192 missense probably damaging 1.00
R5090:Hmgcr UTSW 13 96650590 missense probably benign
R5113:Hmgcr UTSW 13 96656732 missense probably benign 0.00
R5209:Hmgcr UTSW 13 96666512 splice site probably benign
R5354:Hmgcr UTSW 13 96654896 missense probably benign 0.26
R5571:Hmgcr UTSW 13 96666663 missense probably benign 0.11
R5804:Hmgcr UTSW 13 96666187 missense probably damaging 0.98
R5886:Hmgcr UTSW 13 96660183 missense probably damaging 1.00
R6340:Hmgcr UTSW 13 96665858 missense probably damaging 1.00
R6638:Hmgcr UTSW 13 96658982 missense probably benign
R6699:Hmgcr UTSW 13 96660209 missense probably damaging 1.00
R7024:Hmgcr UTSW 13 96658910 missense probably benign 0.10
R7061:Hmgcr UTSW 13 96666148 missense possibly damaging 0.64
R7284:Hmgcr UTSW 13 96652665 missense probably damaging 1.00
R7286:Hmgcr UTSW 13 96666597 missense probably damaging 1.00
R7705:Hmgcr UTSW 13 96656723 missense probably benign 0.01
R7709:Hmgcr UTSW 13 96663097 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTACTGACGAAAGCTTCTGG -3'
(R):5'- GCAGGCTAAGGTTTCCTTGG -3'

Sequencing Primer
(F):5'- TGGTTCCTTCTCACAAGCAGAGG -3'
(R):5'- TCTGGACGAAGATGTGTCCAAG -3'
Posted On2015-04-06