Incidental Mutation 'R3840:Mastl'
ID277093
Institutional Source Beutler Lab
Gene Symbol Mastl
Ensembl Gene ENSMUSG00000026779
Gene Namemicrotubule associated serine/threonine kinase-like
Synonyms2700091H24Rik, THC2
MMRRC Submission 040780-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3840 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location23115606-23156024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23140551 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 202 (D202G)
Ref Sequence ENSEMBL: ENSMUSP00000028119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028119]
Predicted Effect probably damaging
Transcript: ENSMUST00000028119
AA Change: D202G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779
AA Change: D202G

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 34 194 2.6e-24 PFAM
Pfam:Pkinase 34 200 2.3e-39 PFAM
low complexity region 297 313 N/A INTRINSIC
Pfam:Pkinase 710 821 6.4e-19 PFAM
Pfam:Pkinase_Tyr 714 818 5.1e-6 PFAM
S_TK_X 822 864 2.01e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136207
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Abcc8 A G 7: 46,108,100 I1375T possibly damaging Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Elmsan1 T C 12: 84,171,609 R526G probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr129 A G 17: 38,055,348 S73P probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Slc22a13 T C 9: 119,208,789 D91G probably benign Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tnfrsf23 A G 7: 143,681,529 S33P probably benign Het
Tro A G X: 150,646,202 probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Wac C A 18: 7,918,535 P416H probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in Mastl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Mastl APN 2 23146148 missense probably damaging 1.00
IGL02103:Mastl APN 2 23139998 missense probably benign 0.01
IGL02622:Mastl APN 2 23132845 missense probably benign 0.12
IGL02826:Mastl APN 2 23145409 missense probably damaging 1.00
IGL02896:Mastl APN 2 23131767 missense probably damaging 1.00
IGL03024:Mastl APN 2 23139919 missense probably damaging 1.00
IGL03038:Mastl APN 2 23140615 splice site probably benign
R0600:Mastl UTSW 2 23133346 missense probably benign 0.06
R0712:Mastl UTSW 2 23150993 missense probably damaging 1.00
R1168:Mastl UTSW 2 23133132 missense probably benign 0.06
R1750:Mastl UTSW 2 23146081 nonsense probably null
R1911:Mastl UTSW 2 23132680 nonsense probably null
R2051:Mastl UTSW 2 23132824 missense possibly damaging 0.49
R2859:Mastl UTSW 2 23139967 missense probably damaging 0.99
R3799:Mastl UTSW 2 23140492 splice site probably benign
R4807:Mastl UTSW 2 23132843 missense probably benign
R4818:Mastl UTSW 2 23137026 missense probably benign 0.00
R4845:Mastl UTSW 2 23139998 missense probably benign 0.01
R5338:Mastl UTSW 2 23133491 missense probably benign 0.01
R5364:Mastl UTSW 2 23133653 missense probably benign 0.16
R6077:Mastl UTSW 2 23155794 missense probably damaging 0.99
R6158:Mastl UTSW 2 23132772 missense possibly damaging 0.92
R6450:Mastl UTSW 2 23120929 missense probably damaging 1.00
R6602:Mastl UTSW 2 23132677 missense probably benign 0.04
R6788:Mastl UTSW 2 23133698 missense probably benign 0.22
R6908:Mastl UTSW 2 23155976 start gained probably benign
R7058:Mastl UTSW 2 23133413 nonsense probably null
R7233:Mastl UTSW 2 23133658 missense probably benign
R7249:Mastl UTSW 2 23146139 missense probably damaging 1.00
R7347:Mastl UTSW 2 23133389 missense probably damaging 0.99
R7371:Mastl UTSW 2 23140573 missense probably damaging 1.00
R7726:Mastl UTSW 2 23140795 splice site probably null
R8057:Mastl UTSW 2 23133554 missense possibly damaging 0.75
R8288:Mastl UTSW 2 23133359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGATAGATGTTCTACCACCTG -3'
(R):5'- CTATACCAGCCAGTTCTGTGGG -3'

Sequencing Primer
(F):5'- ACTGCCAAAGGTAATCCCATCTCAG -3'
(R):5'- CTGTGGGTACAGTTTCTAACA -3'
Posted On2015-04-06