Incidental Mutation 'R3840:Epc2'
ID277094
Institutional Source Beutler Lab
Gene Symbol Epc2
Ensembl Gene ENSMUSG00000069495
Gene Nameenhancer of polycomb homolog 2
SynonymsD2Ertd694e
MMRRC Submission 040780-MU
Accession Numbers

Ncbi RefSeq: NM_172663.4; MGI:1278321

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3840 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location49451486-49551948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49488738 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 68 (K68R)
Ref Sequence ENSEMBL: ENSMUSP00000089758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092123]
Predicted Effect probably damaging
Transcript: ENSMUST00000092123
AA Change: K68R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089758
Gene: ENSMUSG00000069495
AA Change: K68R

DomainStartEndE-ValueType
Pfam:EPL1 7 149 6.5e-18 PFAM
low complexity region 334 342 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:E_Pc_C 578 808 2.1e-70 PFAM
Meta Mutation Damage Score 0.1827 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI

All alleles(45) : Targeted(3) Gene trapped(42)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Abcc8 A G 7: 46,108,100 I1375T possibly damaging Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Elmsan1 T C 12: 84,171,609 R526G probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Mastl T C 2: 23,140,551 D202G probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr129 A G 17: 38,055,348 S73P probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Slc22a13 T C 9: 119,208,789 D91G probably benign Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tnfrsf23 A G 7: 143,681,529 S33P probably benign Het
Tro A G X: 150,646,202 probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Wac C A 18: 7,918,535 P416H probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in Epc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01921:Epc2 APN 2 49532197 missense probably damaging 1.00
IGL02479:Epc2 APN 2 49532135 missense probably benign 0.00
IGL03342:Epc2 APN 2 49536646 missense probably benign 0.02
IGL02984:Epc2 UTSW 2 49528854 missense probably damaging 1.00
R0014:Epc2 UTSW 2 49522525 nonsense probably null
R0014:Epc2 UTSW 2 49522525 nonsense probably null
R0360:Epc2 UTSW 2 49537133 missense possibly damaging 0.81
R0364:Epc2 UTSW 2 49537133 missense possibly damaging 0.81
R0401:Epc2 UTSW 2 49528974 missense probably damaging 0.99
R1269:Epc2 UTSW 2 49522576 missense probably benign 0.38
R1495:Epc2 UTSW 2 49536663 missense probably damaging 1.00
R1573:Epc2 UTSW 2 49549972 missense possibly damaging 0.81
R1619:Epc2 UTSW 2 49549978 missense probably damaging 0.99
R1721:Epc2 UTSW 2 49532105 missense probably damaging 1.00
R1847:Epc2 UTSW 2 49532089 missense probably damaging 1.00
R1867:Epc2 UTSW 2 49532105 missense probably damaging 1.00
R2113:Epc2 UTSW 2 49532223 missense probably benign
R2120:Epc2 UTSW 2 49547609 splice site probably benign
R3841:Epc2 UTSW 2 49488738 missense probably damaging 1.00
R4366:Epc2 UTSW 2 49547554 missense possibly damaging 0.84
R4864:Epc2 UTSW 2 49537165 missense probably benign
R5335:Epc2 UTSW 2 49513230 missense probably benign 0.39
R5639:Epc2 UTSW 2 49451891 missense possibly damaging 0.78
R5695:Epc2 UTSW 2 49547607 critical splice donor site probably null
R6259:Epc2 UTSW 2 49488854 splice site probably null
R6420:Epc2 UTSW 2 49451900 missense probably damaging 0.98
R6667:Epc2 UTSW 2 49522669 missense probably damaging 0.99
R6788:Epc2 UTSW 2 49532087 missense probably benign 0.32
R7061:Epc2 UTSW 2 49535322 missense probably damaging 1.00
R7672:Epc2 UTSW 2 49545819 missense possibly damaging 0.56
R8377:Epc2 UTSW 2 49522515 missense probably damaging 0.99
RF009:Epc2 UTSW 2 49532237 critical splice donor site probably null
Z1176:Epc2 UTSW 2 49535300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAAGGAGAACTATTCCAAATCG -3'
(R):5'- ACTCAAAGTGATCTCCAAGCTC -3'

Sequencing Primer
(F):5'- GAGAACTATTCCAAATCGATTTTTGC -3'
(R):5'- TCAAAGTGATCTCCAAGCTCAAATG -3'
Posted On2015-04-06