Incidental Mutation 'R3840:Slc4a11'
ID277100
Institutional Source Beutler Lab
Gene Symbol Slc4a11
Ensembl Gene ENSMUSG00000074796
Gene Namesolute carrier family 4, sodium bicarbonate transporter-like, member 11
Synonyms
MMRRC Submission 040780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R3840 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130684113-130697519 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130688054 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 268 (F268S)
Ref Sequence ENSEMBL: ENSMUSP00000096963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099362] [ENSMUST00000127397]
Predicted Effect probably damaging
Transcript: ENSMUST00000099362
AA Change: F268S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096963
Gene: ENSMUSG00000074796
AA Change: F268S

DomainStartEndE-ValueType
SCOP:d1a3aa_ 199 276 5e-5 SMART
Pfam:HCO3_cotransp 308 806 9.7e-153 PFAM
transmembrane domain 827 844 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144945
Meta Mutation Damage Score 0.9587 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-regulated, electrogenic sodium-coupled borate cotransporter that is essential for borate homeostasis, cell growth and cell proliferation. Mutations in this gene have been associated with a number of endothelial corneal dystrophies including recessive corneal endothelial dystrophy 2, corneal dystrophy and perceptive deafness, and Fuchs endothelial corneal dystrophy. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele show a collapsed vestibular labyrinth, reduced brainstem auditory potentials, and altered corneal epithelium. Mice homozygous for a reporter allele show corneal endothelial dystrophy, polyuria, natriuresis, urinehypoosmolarity and impaired hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Abcc8 A G 7: 46,108,100 I1375T possibly damaging Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Elmsan1 T C 12: 84,171,609 R526G probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Mastl T C 2: 23,140,551 D202G probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr129 A G 17: 38,055,348 S73P probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Slc22a13 T C 9: 119,208,789 D91G probably benign Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tnfrsf23 A G 7: 143,681,529 S33P probably benign Het
Tro A G X: 150,646,202 probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Wac C A 18: 7,918,535 P416H probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in Slc4a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Slc4a11 APN 2 130688138 missense probably benign 0.11
IGL01292:Slc4a11 APN 2 130690832 critical splice donor site probably null
IGL01330:Slc4a11 APN 2 130687682 missense probably benign 0.11
IGL01349:Slc4a11 APN 2 130686943 missense probably benign 0.33
IGL01474:Slc4a11 APN 2 130685544 missense probably damaging 1.00
IGL01528:Slc4a11 APN 2 130685408 unclassified probably benign
IGL01752:Slc4a11 APN 2 130688145 missense probably damaging 1.00
IGL01859:Slc4a11 APN 2 130684994 missense probably damaging 1.00
IGL01914:Slc4a11 APN 2 130687279 missense probably damaging 1.00
IGL02367:Slc4a11 APN 2 130684959 missense probably damaging 1.00
IGL02373:Slc4a11 APN 2 130684898 missense probably benign 0.07
IGL02516:Slc4a11 APN 2 130691393 missense possibly damaging 0.89
IGL02894:Slc4a11 APN 2 130687155 splice site probably null
R0029:Slc4a11 UTSW 2 130688054 missense probably damaging 1.00
R0077:Slc4a11 UTSW 2 130686301 unclassified probably benign
R0270:Slc4a11 UTSW 2 130690932 missense possibly damaging 0.89
R0502:Slc4a11 UTSW 2 130688157 missense probably damaging 1.00
R1316:Slc4a11 UTSW 2 130686151 missense probably benign 0.01
R1628:Slc4a11 UTSW 2 130687127 intron probably null
R1859:Slc4a11 UTSW 2 130688012 missense probably benign 0.00
R2235:Slc4a11 UTSW 2 130685624 missense probably benign 0.19
R2247:Slc4a11 UTSW 2 130687801 missense probably benign 0.00
R2332:Slc4a11 UTSW 2 130684459 missense probably benign 0.17
R3890:Slc4a11 UTSW 2 130685785 missense probably damaging 0.98
R4296:Slc4a11 UTSW 2 130685007 missense probably benign 0.01
R4304:Slc4a11 UTSW 2 130688138 missense probably benign 0.11
R4749:Slc4a11 UTSW 2 130690867 missense probably damaging 1.00
R4927:Slc4a11 UTSW 2 130684946 missense probably damaging 0.99
R4939:Slc4a11 UTSW 2 130684868 missense probably damaging 1.00
R5756:Slc4a11 UTSW 2 130687863 missense probably benign 0.13
R5869:Slc4a11 UTSW 2 130684459 missense probably benign 0.04
R5905:Slc4a11 UTSW 2 130685052 missense probably damaging 1.00
R6709:Slc4a11 UTSW 2 130684696 missense probably damaging 1.00
R7337:Slc4a11 UTSW 2 130685532 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCAGATGCCCTTTCCAAAAG -3'
(R):5'- GACCTCACTTGGCAAAGACAG -3'

Sequencing Primer
(F):5'- AAAAAGTCCTTGCATTTCGGGG -3'
(R):5'- ACAGGGTGTCCTCTGCTG -3'
Posted On2015-04-06