Incidental Mutation 'R3840:Rap1gap'
ID277103
Institutional Source Beutler Lab
Gene Symbol Rap1gap
Ensembl Gene ENSMUSG00000041351
Gene NameRap1 GTPase-activating protein
Synonyms1300019I11Rik, 2310004O14Rik, Rap1ga1
MMRRC Submission 040780-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3840 (G1)
Quality Score111
Status Not validated
Chromosome4
Chromosomal Location137664726-137729861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137717447 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 182 (F182S)
Ref Sequence ENSEMBL: ENSMUSP00000123561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047243] [ENSMUST00000097837] [ENSMUST00000105835] [ENSMUST00000141306] [ENSMUST00000150928] [ENSMUST00000152567]
Predicted Effect probably damaging
Transcript: ENSMUST00000047243
AA Change: F257S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042473
Gene: ENSMUSG00000041351
AA Change: F257S

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 274 461 1.4e-64 PFAM
low complexity region 485 495 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097837
AA Change: F224S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095448
Gene: ENSMUSG00000041351
AA Change: F224S

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
GoLoco 26 48 4.94e-10 SMART
Pfam:Rap_GAP 241 428 1.2e-64 PFAM
low complexity region 452 462 N/A INTRINSIC
low complexity region 597 608 N/A INTRINSIC
low complexity region 647 662 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105835
AA Change: F257S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101461
Gene: ENSMUSG00000041351
AA Change: F257S

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 274 455 4.5e-66 PFAM
low complexity region 485 495 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139831
Predicted Effect probably benign
Transcript: ENSMUST00000141306
SMART Domains Protein: ENSMUSP00000122315
Gene: ENSMUSG00000041351

DomainStartEndE-ValueType
Pfam:Rap_GAP 1 117 1.4e-32 PFAM
low complexity region 141 151 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150928
AA Change: F182S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123561
Gene: ENSMUSG00000041351
AA Change: F182S

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 199 241 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152567
SMART Domains Protein: ENSMUSP00000115391
Gene: ENSMUSG00000041351

DomainStartEndE-ValueType
GoLoco 47 69 4.94e-10 SMART
PDB:1SRQ|D 127 165 4e-20 PDB
Meta Mutation Damage Score 0.9541 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type of GTPase-activating-protein (GAP) that down-regulates the activity of the ras-related RAP1 protein. RAP1 acts as a molecular switch by cycling between an inactive GDP-bound form and an active GTP-bound form. The product of this gene, RAP1GAP, promotes the hydrolysis of bound GTP and hence returns RAP1 to the inactive state whereas other proteins, guanine nucleotide exchange factors (GEFs), act as RAP1 activators by facilitating the conversion of RAP1 from the GDP- to the GTP-bound form. In general, ras subfamily proteins, such as RAP1, play key roles in receptor-linked signaling pathways that control cell growth and differentiation. RAP1 plays a role in diverse processes such as cell proliferation, adhesion, differentiation, and embryogenesis. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Abcc8 A G 7: 46,108,100 I1375T possibly damaging Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Elmsan1 T C 12: 84,171,609 R526G probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Mastl T C 2: 23,140,551 D202G probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr129 A G 17: 38,055,348 S73P probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Slc22a13 T C 9: 119,208,789 D91G probably benign Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tnfrsf23 A G 7: 143,681,529 S33P probably benign Het
Tro A G X: 150,646,202 probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Wac C A 18: 7,918,535 P416H probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in Rap1gap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Rap1gap APN 4 137716524 missense probably damaging 0.98
IGL01810:Rap1gap APN 4 137716155 missense probably benign 0.07
IGL01944:Rap1gap APN 4 137725620 missense probably damaging 1.00
IGL02117:Rap1gap APN 4 137727044 missense probably damaging 0.98
IGL02271:Rap1gap APN 4 137718006 missense probably damaging 1.00
IGL02272:Rap1gap APN 4 137716566 missense probably damaging 1.00
IGL02590:Rap1gap APN 4 137720300 missense probably damaging 0.98
IGL02626:Rap1gap APN 4 137727053 missense probably benign 0.00
IGL03211:Rap1gap APN 4 137715846 critical splice donor site probably null
R0243:Rap1gap UTSW 4 137719351 missense probably damaging 0.99
R1239:Rap1gap UTSW 4 137717996 missense probably damaging 1.00
R1246:Rap1gap UTSW 4 137712094 missense possibly damaging 0.86
R2264:Rap1gap UTSW 4 137727723 missense probably benign
R2935:Rap1gap UTSW 4 137724731 missense probably benign 0.19
R3841:Rap1gap UTSW 4 137717447 missense probably damaging 1.00
R4619:Rap1gap UTSW 4 137716111 missense probably damaging 1.00
R4821:Rap1gap UTSW 4 137712129 missense probably damaging 0.99
R4998:Rap1gap UTSW 4 137728284 missense possibly damaging 0.80
R5061:Rap1gap UTSW 4 137720433 critical splice donor site probably null
R5800:Rap1gap UTSW 4 137720377 missense probably benign 0.00
R6259:Rap1gap UTSW 4 137681757 critical splice donor site probably null
R7082:Rap1gap UTSW 4 137718936 missense probably damaging 1.00
R7098:Rap1gap UTSW 4 137716082 splice site probably null
R7234:Rap1gap UTSW 4 137728540 nonsense probably null
R7580:Rap1gap UTSW 4 137719982 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTGAAGCCTTTGAAAGCG -3'
(R):5'- TTCCTCAGAGGTCTGGAGAC -3'

Sequencing Primer
(F):5'- CCTTTGAAAGCGAGGGGC -3'
(R):5'- TTCCTCCCAGAGTGGCCATG -3'
Posted On2015-04-06