Incidental Mutation 'R3840:Nr2c2'
ID277108
Institutional Source Beutler Lab
Gene Symbol Nr2c2
Ensembl Gene ENSMUSG00000005893
Gene Namenuclear receptor subfamily 2, group C, member 2
SynonymsTAK1, Tr4
MMRRC Submission 040780-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.610) question?
Stock #R3840 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location92091390-92174294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 92163138 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 464 (R464W)
Ref Sequence ENSEMBL: ENSMUSP00000138465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113460] [ENSMUST00000113463] [ENSMUST00000146175]
Predicted Effect probably damaging
Transcript: ENSMUST00000113460
AA Change: R464W

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109087
Gene: ENSMUSG00000005893
AA Change: R464W

DomainStartEndE-ValueType
ZnF_C4 114 185 4.33e-40 SMART
Blast:HOLI 238 324 4e-46 BLAST
HOLI 388 554 1.9e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113463
AA Change: R497W

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109090
Gene: ENSMUSG00000005893
AA Change: R497W

DomainStartEndE-ValueType
ZnF_C4 147 218 4.33e-40 SMART
Blast:HOLI 271 357 6e-46 BLAST
HOLI 421 587 1.9e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146175
AA Change: R464W

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138465
Gene: ENSMUSG00000005893
AA Change: R464W

DomainStartEndE-ValueType
ZnF_C4 114 185 4.33e-40 SMART
Blast:HOLI 238 324 7e-47 BLAST
Pfam:Hormone_recep 367 493 8.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204497
Meta Mutation Damage Score 0.2279 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the nuclear hormone receptor family. Members of this family act as ligand-activated transcription factors and function in many biological processes such as development, cellular differentiation and homeostasis. The activated receptor/ligand complex is translocated to the nucleus where it binds to hormone response elements of target genes. The protein encoded by this gene plays a role in protecting cells from oxidative stress and damage induced by ionizing radiation. The lack of a similar gene in mouse results in growth retardation, severe spinal curvature, subfertility, premature aging, and prostatic intraepithelial neoplasia (PIN) development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display reduced body size, reduced male fertility, and impaired spermatogenesis. Mice homozygous for a conditional allele activated in the CNS exhibit increased thermal, mechanical and chemical nociception threshold, decreased pruritus and neuronal loss in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Abcc8 A G 7: 46,108,100 I1375T possibly damaging Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Elmsan1 T C 12: 84,171,609 R526G probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Mastl T C 2: 23,140,551 D202G probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Olfr129 A G 17: 38,055,348 S73P probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Slc22a13 T C 9: 119,208,789 D91G probably benign Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tnfrsf23 A G 7: 143,681,529 S33P probably benign Het
Tro A G X: 150,646,202 probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Wac C A 18: 7,918,535 P416H probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in Nr2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Nr2c2 APN 6 92149719 missense probably damaging 1.00
IGL01129:Nr2c2 APN 6 92158416 missense probably benign 0.08
IGL01578:Nr2c2 APN 6 92162038 missense probably benign 0.01
IGL02281:Nr2c2 APN 6 92154514 missense probably benign 0.20
R1385:Nr2c2 UTSW 6 92154470 missense probably damaging 1.00
R1397:Nr2c2 UTSW 6 92149764 missense probably benign 0.34
R1503:Nr2c2 UTSW 6 92105331 missense probably benign
R1691:Nr2c2 UTSW 6 92156692 missense probably damaging 0.99
R1779:Nr2c2 UTSW 6 92159243 missense possibly damaging 0.50
R2655:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R3841:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R3923:Nr2c2 UTSW 6 92160401 missense probably damaging 0.98
R3926:Nr2c2 UTSW 6 92160401 missense probably damaging 0.98
R3945:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R3946:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R4721:Nr2c2 UTSW 6 92139847 missense possibly damaging 0.49
R5038:Nr2c2 UTSW 6 92139822 missense probably damaging 1.00
R5101:Nr2c2 UTSW 6 92154516 critical splice donor site probably null
R5524:Nr2c2 UTSW 6 92139765 splice site probably null
R6884:Nr2c2 UTSW 6 92158393 missense probably benign 0.05
R7046:Nr2c2 UTSW 6 92158357 missense probably damaging 1.00
R7278:Nr2c2 UTSW 6 92159378 missense probably damaging 0.96
R7316:Nr2c2 UTSW 6 92154463 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATCTGGAAATGCAGCCC -3'
(R):5'- CCCCAGGAACATTTCTTTAGGG -3'

Sequencing Primer
(F):5'- TCTGGAAATGCAGCCCTTGAC -3'
(R):5'- AGGGCTTTCCTACACAACTGATG -3'
Posted On2015-04-06