Incidental Mutation 'R3840:Olfr593'
ID277110
Institutional Source Beutler Lab
Gene Symbol Olfr593
Ensembl Gene ENSMUSG00000073955
Gene Nameolfactory receptor 593
SynonymsGA_x6K02T2PBJ9-5927412-5928362, MOR24-2
MMRRC Submission 040780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R3840 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103211862-103212845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103212693 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 267 (G267R)
Ref Sequence ENSEMBL: ENSMUSP00000147588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098206] [ENSMUST00000210686] [ENSMUST00000214051]
Predicted Effect probably damaging
Transcript: ENSMUST00000098206
AA Change: G278R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095807
Gene: ENSMUSG00000073955
AA Change: G278R

DomainStartEndE-ValueType
Pfam:7tm_4 44 323 4.9e-106 PFAM
Pfam:7TM_GPCR_Srsx 48 320 2.6e-8 PFAM
Pfam:7tm_1 54 305 6.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210686
AA Change: G267R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214051
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Abcc8 A G 7: 46,108,100 I1375T possibly damaging Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Elmsan1 T C 12: 84,171,609 R526G probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Mastl T C 2: 23,140,551 D202G probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr129 A G 17: 38,055,348 S73P probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Slc22a13 T C 9: 119,208,789 D91G probably benign Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tnfrsf23 A G 7: 143,681,529 S33P probably benign Het
Tro A G X: 150,646,202 probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Wac C A 18: 7,918,535 P416H probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in Olfr593
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Olfr593 APN 7 103212685 missense probably damaging 1.00
IGL01636:Olfr593 APN 7 103212177 missense probably benign
IGL01637:Olfr593 APN 7 103212177 missense probably benign
IGL02115:Olfr593 APN 7 103212474 missense probably damaging 1.00
IGL02668:Olfr593 APN 7 103212735 missense possibly damaging 0.88
IGL03063:Olfr593 APN 7 103212634 missense probably damaging 0.96
IGL03070:Olfr593 APN 7 103212697 missense probably benign 0.02
IGL03114:Olfr593 APN 7 103212721 missense probably damaging 1.00
R0144:Olfr593 UTSW 7 103212540 missense probably damaging 1.00
R0238:Olfr593 UTSW 7 103212726 missense possibly damaging 0.93
R0238:Olfr593 UTSW 7 103212726 missense possibly damaging 0.93
R0239:Olfr593 UTSW 7 103212726 missense possibly damaging 0.93
R0239:Olfr593 UTSW 7 103212726 missense possibly damaging 0.93
R0309:Olfr593 UTSW 7 103212721 missense probably damaging 1.00
R0602:Olfr593 UTSW 7 103212580 missense possibly damaging 0.76
R0677:Olfr593 UTSW 7 103212798 nonsense probably null
R0783:Olfr593 UTSW 7 103212670 missense probably damaging 1.00
R1829:Olfr593 UTSW 7 103211886 missense probably benign 0.01
R3841:Olfr593 UTSW 7 103212693 missense probably damaging 1.00
R4449:Olfr593 UTSW 7 103212480 missense probably benign 0.00
R4898:Olfr593 UTSW 7 103212540 missense probably damaging 1.00
R5197:Olfr593 UTSW 7 103212000 missense probably benign 0.02
R5285:Olfr593 UTSW 7 103212798 nonsense probably null
R6548:Olfr593 UTSW 7 103211904 missense probably benign 0.08
R7353:Olfr593 UTSW 7 103212309 missense probably damaging 1.00
R7362:Olfr593 UTSW 7 103212654 missense probably damaging 1.00
R7663:Olfr593 UTSW 7 103212445 missense possibly damaging 0.74
R7799:Olfr593 UTSW 7 103211979 missense probably benign 0.33
R8405:Olfr593 UTSW 7 103212201 missense probably benign 0.31
R8835:Olfr593 UTSW 7 103212721 missense probably damaging 1.00
X0067:Olfr593 UTSW 7 103212048 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGAGACAAGCATCCGCAGAG -3'
(R):5'- CTCATGTCCTAAATTAGGGAAAGGAAC -3'

Sequencing Primer
(F):5'- AGAGCTTACAGCCTCATCGTTG -3'
(R):5'- GGGAAAGGAACATACTTAGATTTCAC -3'
Posted On2015-04-06