Incidental Mutation 'R3840:Tnfrsf23'
ID277112
Institutional Source Beutler Lab
Gene Symbol Tnfrsf23
Ensembl Gene ENSMUSG00000037613
Gene Nametumor necrosis factor receptor superfamily, member 23
SynonymsmSOB, mDcTrailr1, Tnfrh1
MMRRC Submission 040780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3840 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location143665809-143685872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143681529 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 33 (S33P)
Ref Sequence ENSEMBL: ENSMUSP00000146956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035742] [ENSMUST00000152703] [ENSMUST00000208017]
Predicted Effect probably benign
Transcript: ENSMUST00000035742
AA Change: S33P

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000042431
Gene: ENSMUSG00000037613
AA Change: S33P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 38 72 1.55e-1 SMART
TNFR 75 104 3.12e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152703
AA Change: S33P

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116742
Gene: ENSMUSG00000037613
AA Change: S33P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 38 72 1.55e-1 SMART
TNFR 75 114 1.29e-7 SMART
TNFR 116 155 2.14e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208017
AA Change: S33P

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208613
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the tumor necrosis factor superfamily of proteins. The encoded receptor has been shown to bind to the ligand TRAIL (tumor necrosis factor-related apoptosis-inducing ligand), but to have no signaling capacity. This gene shows elevated expression in mice with diet-induced fatty liver disease. This gene and other family members are present in a gene cluster on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Abcc8 A G 7: 46,108,100 I1375T possibly damaging Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Elmsan1 T C 12: 84,171,609 R526G probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Mastl T C 2: 23,140,551 D202G probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr129 A G 17: 38,055,348 S73P probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Slc22a13 T C 9: 119,208,789 D91G probably benign Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tro A G X: 150,646,202 probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Wac C A 18: 7,918,535 P416H probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in Tnfrsf23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Tnfrsf23 APN 7 143679999 missense probably damaging 0.99
IGL02409:Tnfrsf23 APN 7 143668571 missense probably damaging 0.98
R1936:Tnfrsf23 UTSW 7 143668554 missense probably benign 0.04
R4201:Tnfrsf23 UTSW 7 143670054 missense probably damaging 1.00
R4786:Tnfrsf23 UTSW 7 143680064 missense probably damaging 1.00
R4858:Tnfrsf23 UTSW 7 143681480 missense probably damaging 1.00
R5226:Tnfrsf23 UTSW 7 143685785 missense possibly damaging 0.68
R7687:Tnfrsf23 UTSW 7 143681462 missense probably benign 0.29
R7759:Tnfrsf23 UTSW 7 143670835 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAATGGCTGAGTTGAGCTC -3'
(R):5'- TACAACCTTCCATGGGCAAC -3'

Sequencing Primer
(F):5'- GAGTTGAGCTCCCTGATCCACAC -3'
(R):5'- AACTGCAGGCTTCAGAGTTC -3'
Posted On2015-04-06