Incidental Mutation 'R3840:Zfp617'
ID277114
Institutional Source Beutler Lab
Gene Symbol Zfp617
Ensembl Gene ENSMUSG00000066880
Gene Namezinc finger protein 617
SynonymsZfps11-6, Zinc finger protein s11-6
MMRRC Submission 040780-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R3840 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location71908635-71934629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71932117 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 97 (G97E)
Ref Sequence ENSEMBL: ENSMUSP00000112926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119003] [ENSMUST00000131544]
Predicted Effect probably damaging
Transcript: ENSMUST00000119003
AA Change: G97E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112926
Gene: ENSMUSG00000066880
AA Change: G97E

DomainStartEndE-ValueType
KRAB 4 56 1.08e-10 SMART
ZnF_C2H2 167 189 8.47e-4 SMART
ZnF_C2H2 195 217 8.34e-3 SMART
ZnF_C2H2 223 245 1.28e-3 SMART
ZnF_C2H2 251 273 1.28e-3 SMART
ZnF_C2H2 279 301 1.58e-3 SMART
ZnF_C2H2 307 329 1.28e-3 SMART
ZnF_C2H2 335 357 9.73e-4 SMART
ZnF_C2H2 363 385 6.42e-4 SMART
ZnF_C2H2 391 413 4.47e-3 SMART
ZnF_C2H2 419 441 1.38e-3 SMART
ZnF_C2H2 447 469 1.2e-3 SMART
ZnF_C2H2 475 497 1.56e-2 SMART
ZnF_C2H2 503 525 2.36e-2 SMART
ZnF_C2H2 531 553 4.98e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131544
AA Change: G97E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120213
Gene: ENSMUSG00000066880
AA Change: G97E

DomainStartEndE-ValueType
KRAB 4 56 1.08e-10 SMART
ZnF_C2H2 167 189 8.47e-4 SMART
ZnF_C2H2 195 217 8.34e-3 SMART
Meta Mutation Damage Score 0.2222 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Abcc8 A G 7: 46,108,100 I1375T possibly damaging Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Elmsan1 T C 12: 84,171,609 R526G probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Mastl T C 2: 23,140,551 D202G probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr129 A G 17: 38,055,348 S73P probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Slc22a13 T C 9: 119,208,789 D91G probably benign Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tnfrsf23 A G 7: 143,681,529 S33P probably benign Het
Tro A G X: 150,646,202 probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Wac C A 18: 7,918,535 P416H probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Other mutations in Zfp617
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Zfp617 APN 8 71932542 nonsense probably null
R2116:Zfp617 UTSW 8 71932165 missense probably benign 0.05
R3841:Zfp617 UTSW 8 71932117 missense probably damaging 1.00
R4587:Zfp617 UTSW 8 71929159 missense probably damaging 0.98
R4691:Zfp617 UTSW 8 71932815 missense probably benign 0.13
R5264:Zfp617 UTSW 8 71933041 missense probably damaging 0.98
R5783:Zfp617 UTSW 8 71932464 missense probably damaging 1.00
R6046:Zfp617 UTSW 8 71933413 missense probably damaging 1.00
R6197:Zfp617 UTSW 8 71933254 missense probably benign 0.01
R6403:Zfp617 UTSW 8 71929171 missense probably benign 0.26
R6890:Zfp617 UTSW 8 71932166 missense probably benign 0.35
R7124:Zfp617 UTSW 8 71932540 missense probably damaging 1.00
R7582:Zfp617 UTSW 8 71932020 missense probably benign 0.01
R7747:Zfp617 UTSW 8 71928189 splice site probably null
R8907:Zfp617 UTSW 8 71933083 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTTTGACTAGTGGTATTTAAGC -3'
(R):5'- CTCTGGGGAGAACCAAAAGC -3'

Sequencing Primer
(F):5'- TTAAGCTGTCTTATTGAGTCTTCAC -3'
(R):5'- AAAGCCACTCCACTGTCTTTAC -3'
Posted On2015-04-06