Incidental Mutation 'R3840:Slc22a13'
ID277118
Institutional Source Beutler Lab
Gene Symbol Slc22a13
Ensembl Gene ENSMUSG00000074028
Gene Namesolute carrier family 22 (organic cation transporter), member 13
SynonymsOCTL1, ORCTL3, OCTL3
MMRRC Submission 040780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R3840 (G1)
Quality Score206
Status Not validated
Chromosome9
Chromosomal Location119192974-119209098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119208789 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 91 (D91G)
Ref Sequence ENSEMBL: ENSMUSP00000081855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084797] [ENSMUST00000170400]
Predicted Effect probably benign
Transcript: ENSMUST00000084797
AA Change: D91G

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000081855
Gene: ENSMUSG00000074028
AA Change: D91G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 104 514 2.2e-41 PFAM
Pfam:MFS_1 133 468 2.6e-26 PFAM
Pfam:MFS_1 355 537 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic-cation transporter family. It is located in a gene cluster with another member of the family, organic cation transporter like 4. The encoded protein is a transmembrane protein involved in the transport of small molecules. This protein can function to mediate urate uptake and is a high affinity nicotinate exchanger in the kidneys and the intestine. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Abcc8 A G 7: 46,108,100 I1375T possibly damaging Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Elmsan1 T C 12: 84,171,609 R526G probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Mastl T C 2: 23,140,551 D202G probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr129 A G 17: 38,055,348 S73P probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tnfrsf23 A G 7: 143,681,529 S33P probably benign Het
Tro A G X: 150,646,202 probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Wac C A 18: 7,918,535 P416H probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in Slc22a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02828:Slc22a13 APN 9 119195707 missense probably benign 0.25
IGL02871:Slc22a13 APN 9 119196011 missense probably benign 0.01
R0764:Slc22a13 UTSW 9 119208680 splice site probably null
R1469:Slc22a13 UTSW 9 119193295 missense possibly damaging 0.67
R1469:Slc22a13 UTSW 9 119193295 missense possibly damaging 0.67
R1545:Slc22a13 UTSW 9 119209047 missense probably benign 0.00
R2154:Slc22a13 UTSW 9 119208687 missense probably benign 0.00
R2321:Slc22a13 UTSW 9 119195628 missense possibly damaging 0.61
R3808:Slc22a13 UTSW 9 119196077 missense probably benign
R4736:Slc22a13 UTSW 9 119193632 missense probably damaging 1.00
R6286:Slc22a13 UTSW 9 119208712 nonsense probably null
R6899:Slc22a13 UTSW 9 119196407 missense probably damaging 1.00
R7579:Slc22a13 UTSW 9 119195160 missense possibly damaging 0.62
R8755:Slc22a13 UTSW 9 119209060 start codon destroyed probably damaging 0.98
Z1177:Slc22a13 UTSW 9 119193304 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCATACAGGCAACAGGTAGC -3'
(R):5'- GGCATTCCCAATTTCCTGGC -3'

Sequencing Primer
(F):5'- TACAGGCAACAGGTAGCTATATAC -3'
(R):5'- GCTGCATTCTTCATATTTGGCCAAG -3'
Posted On2015-04-06