Incidental Mutation 'R3840:Elmsan1'
ID277124
Institutional Source Beutler Lab
Gene Symbol Elmsan1
Ensembl Gene ENSMUSG00000042507
Gene NameELM2 and Myb/SANT-like domain containing 1
Synonyms9430029N19Rik, C130039O16Rik
MMRRC Submission 040780-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.603) question?
Stock #R3840 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location84149176-84218881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84171609 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 526 (R526G)
Ref Sequence ENSEMBL: ENSMUSP00000152853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046266] [ENSMUST00000110294] [ENSMUST00000220974]
Predicted Effect probably damaging
Transcript: ENSMUST00000046266
AA Change: R526G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048120
Gene: ENSMUSG00000042507
AA Change: R526G

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 107 117 N/A INTRINSIC
low complexity region 124 132 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
ELM2 715 772 6.76e-14 SMART
low complexity region 798 814 N/A INTRINSIC
SANT 821 869 1.44e-5 SMART
low complexity region 906 926 N/A INTRINSIC
low complexity region 942 956 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.72e-2 SMART
low complexity region 1053 1082 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110294
AA Change: R526G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105923
Gene: ENSMUSG00000042507
AA Change: R526G

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 107 117 N/A INTRINSIC
low complexity region 124 132 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
ELM2 715 772 6.76e-14 SMART
low complexity region 798 814 N/A INTRINSIC
SANT 821 869 1.44e-5 SMART
low complexity region 906 926 N/A INTRINSIC
low complexity region 942 956 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.72e-2 SMART
low complexity region 1053 1082 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220974
AA Change: R526G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Abcc8 A G 7: 46,108,100 I1375T possibly damaging Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Mastl T C 2: 23,140,551 D202G probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr129 A G 17: 38,055,348 S73P probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Slc22a13 T C 9: 119,208,789 D91G probably benign Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tnfrsf23 A G 7: 143,681,529 S33P probably benign Het
Tro A G X: 150,646,202 probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Wac C A 18: 7,918,535 P416H probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in Elmsan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Elmsan1 APN 12 84172855 nonsense probably null
IGL00913:Elmsan1 APN 12 84172858 missense probably benign
IGL00944:Elmsan1 APN 12 84160548 splice site probably benign
IGL01108:Elmsan1 APN 12 84173691 missense probably damaging 1.00
IGL01952:Elmsan1 APN 12 84173266 missense probably benign 0.00
IGL01961:Elmsan1 APN 12 84173614 missense probably damaging 1.00
IGL02188:Elmsan1 APN 12 84162326 missense probably benign 0.00
IGL02700:Elmsan1 APN 12 84152862 missense probably benign 0.06
R0645:Elmsan1 UTSW 12 84158303 missense possibly damaging 0.71
R1387:Elmsan1 UTSW 12 84152931 missense probably damaging 0.98
R1740:Elmsan1 UTSW 12 84172902 missense probably damaging 0.99
R1769:Elmsan1 UTSW 12 84158350 splice site probably benign
R1795:Elmsan1 UTSW 12 84158974 critical splice donor site probably null
R2146:Elmsan1 UTSW 12 84173035 missense probably damaging 0.99
R2872:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R2872:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R2940:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3408:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3689:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3691:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4364:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4366:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4392:Elmsan1 UTSW 12 84173111 missense probably benign 0.10
R4439:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4440:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4496:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R5227:Elmsan1 UTSW 12 84152887 missense probably benign 0.10
R6921:Elmsan1 UTSW 12 84156459 missense probably damaging 0.99
R7675:Elmsan1 UTSW 12 84173800 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAAATAGCATCCTCTCATACCTG -3'
(R):5'- ATTCCTAGGTCAGCAAACAGGG -3'

Sequencing Primer
(F):5'- ATACCTGAGCTGCAGCATCTG -3'
(R):5'- AACAGGGGCTCAACTCCTG -3'
Posted On2015-04-06