Incidental Mutation 'R3840:Olfr129'
ID277133
Institutional Source Beutler Lab
Gene Symbol Olfr129
Ensembl Gene ENSMUSG00000081724
Gene Nameolfactory receptor 129
SynonymsGA_x6K02T2PSCP-2503741-2502776, MOR263-9
MMRRC Submission 040780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R3840 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location38050857-38060079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38055348 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 73 (S73P)
Ref Sequence ENSEMBL: ENSMUSP00000149327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122318] [ENSMUST00000174675] [ENSMUST00000216476]
Predicted Effect probably damaging
Transcript: ENSMUST00000122318
AA Change: S82P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113564
Gene: ENSMUSG00000081724
AA Change: S82P

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 4.6e-56 PFAM
Pfam:7TM_GPCR_Srsx 50 319 1.1e-5 PFAM
Pfam:7tm_1 56 305 3.2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174675
AA Change: S73P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133865
Gene: ENSMUSG00000060017
AA Change: S73P

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216476
AA Change: S73P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Abcc8 A G 7: 46,108,100 I1375T possibly damaging Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Elmsan1 T C 12: 84,171,609 R526G probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Mastl T C 2: 23,140,551 D202G probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Slc22a13 T C 9: 119,208,789 D91G probably benign Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tnfrsf23 A G 7: 143,681,529 S33P probably benign Het
Tro A G X: 150,646,202 probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Wac C A 18: 7,918,535 P416H probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in Olfr129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Olfr129 APN 17 38055590 start codon destroyed probably null 0.15
IGL02163:Olfr129 APN 17 38054750 missense probably benign 0.06
IGL02374:Olfr129 APN 17 38055521 missense probably damaging 1.00
R0840:Olfr129 UTSW 17 38055572 missense probably benign 0.00
R1774:Olfr129 UTSW 17 38055437 missense probably benign 0.00
R3720:Olfr129 UTSW 17 38055368 missense probably damaging 1.00
R3794:Olfr129 UTSW 17 38054895 missense probably damaging 1.00
R4002:Olfr129 UTSW 17 38054988 missense probably damaging 1.00
R4273:Olfr129 UTSW 17 38055272 missense probably damaging 1.00
R4872:Olfr129 UTSW 17 38055576 missense probably benign
R5606:Olfr129 UTSW 17 38054802 missense probably damaging 0.98
R6309:Olfr129 UTSW 17 38055152 missense probably damaging 1.00
R7269:Olfr129 UTSW 17 38055551 missense probably damaging 1.00
R7450:Olfr129 UTSW 17 38055109 missense probably benign 0.00
R7829:Olfr129 UTSW 17 38055329 missense possibly damaging 0.64
R8103:Olfr129 UTSW 17 38055012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGCAACCTGTTCCCCATG -3'
(R):5'- GCTTTGCATTTGCCAAGTTC -3'

Sequencing Primer
(F):5'- CCATGAAACTATTGCCAAATGGG -3'
(R):5'- CAAGTTCTCTGAGGTCCCTGGAG -3'
Posted On2015-04-06