Incidental Mutation 'R3840:Wac'
ID277135
Institutional Source Beutler Lab
Gene Symbol Wac
Ensembl Gene ENSMUSG00000024283
Gene NameWW domain containing adaptor with coiled-coil
Synonyms1110067P07Rik, A230035H12Rik, Wwp4
MMRRC Submission 040780-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3840 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location7868832-7973547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 7918535 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 416 (P416H)
Ref Sequence ENSEMBL: ENSMUSP00000128321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074919] [ENSMUST00000092112] [ENSMUST00000166062] [ENSMUST00000167020] [ENSMUST00000168446] [ENSMUST00000169478] [ENSMUST00000170854] [ENSMUST00000171042] [ENSMUST00000171486] [ENSMUST00000172018]
Predicted Effect probably damaging
Transcript: ENSMUST00000074919
AA Change: P419H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074454
Gene: ENSMUSG00000024283
AA Change: P419H

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 287 307 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092112
AA Change: P361H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089746
Gene: ENSMUSG00000024283
AA Change: P361H

DomainStartEndE-ValueType
low complexity region 100 122 N/A INTRINSIC
WW 130 162 2.12e-7 SMART
low complexity region 229 249 N/A INTRINSIC
low complexity region 262 273 N/A INTRINSIC
low complexity region 408 423 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000165854
AA Change: P217H
SMART Domains Protein: ENSMUSP00000126815
Gene: ENSMUSG00000024283
AA Change: P217H

DomainStartEndE-ValueType
low complexity region 20 42 N/A INTRINSIC
WW 50 82 2.12e-7 SMART
low complexity region 265 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166062
SMART Domains Protein: ENSMUSP00000132532
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 287 307 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167020
AA Change: P464H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132117
Gene: ENSMUSG00000024283
AA Change: P464H

DomainStartEndE-ValueType
low complexity region 100 122 N/A INTRINSIC
WW 130 162 2.12e-7 SMART
low complexity region 252 267 N/A INTRINSIC
low complexity region 332 352 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 511 526 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167057
Predicted Effect probably benign
Transcript: ENSMUST00000167542
SMART Domains Protein: ENSMUSP00000125989
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 95 115 N/A INTRINSIC
low complexity region 128 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168446
SMART Domains Protein: ENSMUSP00000131032
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 106 128 N/A INTRINSIC
WW 136 168 2.12e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169478
AA Change: P47H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130467
Gene: ENSMUSG00000024283
AA Change: P47H

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170854
SMART Domains Protein: ENSMUSP00000131141
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 100 115 N/A INTRINSIC
low complexity region 187 207 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171042
AA Change: P312H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133185
Gene: ENSMUSG00000024283
AA Change: P312H

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 184 204 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
low complexity region 359 374 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171486
AA Change: P313H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127848
Gene: ENSMUSG00000024283
AA Change: P313H

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 184 204 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
low complexity region 360 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172018
AA Change: P416H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128321
Gene: ENSMUSG00000024283
AA Change: P416H

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 287 307 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a WW domain, which is a protein module found in a wide range of signaling proteins. This domain mediates protein-protein interactions and binds proteins containing short linear peptide motifs that are proline-rich or contain at least one proline. This gene product shares 94% sequence identity with the WAC protein in mouse, however, its exact function is not known. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Abcc8 A G 7: 46,108,100 I1375T possibly damaging Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Elmsan1 T C 12: 84,171,609 R526G probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Mastl T C 2: 23,140,551 D202G probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr129 A G 17: 38,055,348 S73P probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Slc22a13 T C 9: 119,208,789 D91G probably benign Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tnfrsf23 A G 7: 143,681,529 S33P probably benign Het
Tro A G X: 150,646,202 probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in Wac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02404:Wac APN 18 7917570 missense probably damaging 1.00
R1077:Wac UTSW 18 7921916 missense probably damaging 1.00
R2915:Wac UTSW 18 7926131 missense possibly damaging 0.96
R3196:Wac UTSW 18 7917568 missense probably damaging 1.00
R3793:Wac UTSW 18 7920190 missense possibly damaging 0.86
R3971:Wac UTSW 18 7916175 missense probably damaging 1.00
R6402:Wac UTSW 18 7901585 missense possibly damaging 0.71
R6429:Wac UTSW 18 7920163 missense probably damaging 0.97
R6536:Wac UTSW 18 7905189 unclassified probably null
R6615:Wac UTSW 18 7868884 unclassified probably null
R6645:Wac UTSW 18 7973523 missense probably damaging 1.00
R7088:Wac UTSW 18 7921455 missense probably damaging 0.99
R7464:Wac UTSW 18 7871746 critical splice donor site probably null
X0066:Wac UTSW 18 7916298 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CGTTCAGTAAGGACATCACATTCTG -3'
(R):5'- ATCTAATCTCAGCCAGCTGCC -3'

Sequencing Primer
(F):5'- CTGTGTGGAGTAACATAGCAAACCTC -3'
(R):5'- AGCCAGCTGCCGTTCATTC -3'
Posted On2015-04-06