Incidental Mutation 'R3840:Tro'
ID277139
Institutional Source Beutler Lab
Gene Symbol Tro
Ensembl Gene ENSMUSG00000025272
Gene Nametrophinin
SynonymsMaged3, Maged3l, magphinin, magphinin-alpha, magphinin-beta 2, magphinin-gamma, necdin and trophinin like, Tnn, Trol, trophinin-2
MMRRC Submission 040780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R3840 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location150645304-150657583 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 150646202 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080884] [ENSMUST00000087253] [ENSMUST00000087258] [ENSMUST00000112709] [ENSMUST00000112713] [ENSMUST00000151403] [ENSMUST00000163450] [ENSMUST00000163969] [ENSMUST00000164071]
Predicted Effect probably benign
Transcript: ENSMUST00000080884
SMART Domains Protein: ENSMUSP00000079692
Gene: ENSMUSG00000025271

DomainStartEndE-ValueType
Pfam:Zeta_toxin 2 135 2.6e-8 PFAM
Pfam:6PF2K 7 228 3.1e-106 PFAM
Pfam:AAA_33 21 177 1.1e-11 PFAM
PGAM 230 377 8.92e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087253
SMART Domains Protein: ENSMUSP00000084508
Gene: ENSMUSG00000025272

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_2 62 105 5.33e-6 PROSPERO
internal_repeat_1 95 280 8.68e-15 PROSPERO
internal_repeat_2 120 164 5.33e-6 PROSPERO
internal_repeat_1 275 441 8.68e-15 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 8e-60 PFAM
SCOP:d1gt91_ 780 951 9e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000087258
AA Change: S1923P
SMART Domains Protein: ENSMUSP00000084513
Gene: ENSMUSG00000025272
AA Change: S1923P

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_3 62 105 6.04e-6 PROSPERO
internal_repeat_2 95 280 2.73e-15 PROSPERO
internal_repeat_3 120 164 6.04e-6 PROSPERO
internal_repeat_2 275 441 2.73e-15 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 1.6e-58 PFAM
low complexity region 794 810 N/A INTRINSIC
low complexity region 891 1028 N/A INTRINSIC
low complexity region 1057 1073 N/A INTRINSIC
low complexity region 1087 1108 N/A INTRINSIC
low complexity region 1110 1142 N/A INTRINSIC
low complexity region 1144 1155 N/A INTRINSIC
low complexity region 1157 1175 N/A INTRINSIC
internal_repeat_1 1176 1361 9.97e-23 PROSPERO
low complexity region 1393 1409 N/A INTRINSIC
internal_repeat_1 1540 1728 9.97e-23 PROSPERO
low complexity region 1764 1786 N/A INTRINSIC
low complexity region 1790 1815 N/A INTRINSIC
low complexity region 1821 1836 N/A INTRINSIC
low complexity region 1870 1910 N/A INTRINSIC
low complexity region 1915 1931 N/A INTRINSIC
low complexity region 1962 2085 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112709
AA Change: S1923P
SMART Domains Protein: ENSMUSP00000108329
Gene: ENSMUSG00000025272
AA Change: S1923P

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_3 62 105 6.04e-6 PROSPERO
internal_repeat_2 95 280 2.73e-15 PROSPERO
internal_repeat_3 120 164 6.04e-6 PROSPERO
internal_repeat_2 275 441 2.73e-15 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
MAGE 596 765 2.03e-90 SMART
low complexity region 794 810 N/A INTRINSIC
low complexity region 891 1028 N/A INTRINSIC
low complexity region 1057 1073 N/A INTRINSIC
low complexity region 1087 1108 N/A INTRINSIC
low complexity region 1110 1142 N/A INTRINSIC
low complexity region 1144 1155 N/A INTRINSIC
low complexity region 1157 1175 N/A INTRINSIC
internal_repeat_1 1176 1361 9.97e-23 PROSPERO
low complexity region 1393 1409 N/A INTRINSIC
internal_repeat_1 1540 1728 9.97e-23 PROSPERO
low complexity region 1764 1786 N/A INTRINSIC
low complexity region 1790 1815 N/A INTRINSIC
low complexity region 1821 1836 N/A INTRINSIC
low complexity region 1870 1910 N/A INTRINSIC
low complexity region 1915 1931 N/A INTRINSIC
low complexity region 1962 2085 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112713
SMART Domains Protein: ENSMUSP00000108333
Gene: ENSMUSG00000025271

DomainStartEndE-ValueType
Pfam:6PF2K 30 251 2.7e-106 PFAM
Pfam:AAA_33 44 199 1.6e-10 PFAM
PGAM 253 400 8.92e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150783
Predicted Effect probably benign
Transcript: ENSMUST00000151403
SMART Domains Protein: ENSMUSP00000120457
Gene: ENSMUSG00000025272

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_1 95 280 6.85e-11 PROSPERO
internal_repeat_1 275 441 6.85e-11 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 6.3e-60 PFAM
low complexity region 794 808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154528
Predicted Effect probably benign
Transcript: ENSMUST00000163450
Predicted Effect probably benign
Transcript: ENSMUST00000163969
SMART Domains Protein: ENSMUSP00000126054
Gene: ENSMUSG00000025272

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_1 95 280 5.6e-10 PROSPERO
internal_repeat_1 275 441 5.6e-10 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 5.9e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164071
SMART Domains Protein: ENSMUSP00000126042
Gene: ENSMUSG00000025272

DomainStartEndE-ValueType
Pfam:MAGE 54 223 7.1e-61 PFAM
low complexity region 252 266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171775
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein that mediates cell adhesion between trophoblastic cells and the epithelial cells of the endometrium. The encoded protein participates in cell signalling during embryo implantation, and may also be involved in cancer formation. This gene is located near several other closely related genes on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
PHENOTYPE: Homozygous female or hemizygous male mice on a mixed 129 and NIH black Swiss background are viable, fertile and elderly mice exhibit no disorders. On an inbred 129 background, homozygous female or hemizygous male mice show partial embryonic lethality between E3.5 and E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Abcc8 A G 7: 46,108,100 I1375T possibly damaging Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Elmsan1 T C 12: 84,171,609 R526G probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Mastl T C 2: 23,140,551 D202G probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr129 A G 17: 38,055,348 S73P probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Slc22a13 T C 9: 119,208,789 D91G probably benign Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tnfrsf23 A G 7: 143,681,529 S33P probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Wac C A 18: 7,918,535 P416H probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in Tro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Tro APN X 150655325 missense probably benign 0.45
IGL00818:Tro APN X 150648361 missense probably damaging 1.00
IGL03170:Tro APN X 150655560 missense probably benign 0.36
R0022:Tro UTSW X 150647512 intron probably benign
R0049:Tro UTSW X 150654569 missense possibly damaging 0.56
R1378:Tro UTSW X 150655571 missense probably damaging 1.00
R2228:Tro UTSW X 150655481 missense probably benign 0.17
R3080:Tro UTSW X 150655202 missense probably benign 0.09
R3437:Tro UTSW X 150646256 intron probably benign
R3715:Tro UTSW X 150654234 missense probably damaging 1.00
R3783:Tro UTSW X 150655052 missense possibly damaging 0.83
R3787:Tro UTSW X 150655052 missense possibly damaging 0.83
R4001:Tro UTSW X 150655202 missense probably benign 0.09
R5449:Tro UTSW X 150645970 intron probably benign
R7112:Tro UTSW X 150645856 intron probably benign
R7903:Tro UTSW X 150654520 intron probably benign
R7909:Tro UTSW X 150648624 intron probably benign
Predicted Primers PCR Primer
(F):5'- GAAGCCAGGTCCTGTACTTG -3'
(R):5'- AACACTGATTTTGGTGGTGAACTG -3'

Sequencing Primer
(F):5'- AGGTCCTGTACTTGGTCCAC -3'
(R):5'- TGGTGAACTGGGCACTAGC -3'
Posted On2015-04-06