Incidental Mutation 'R3841:BC035947'
ID277140
Institutional Source Beutler Lab
Gene Symbol BC035947
Ensembl Gene ENSMUSG00000090486
Gene NamecDNA sequence BC035947
Synonyms
MMRRC Submission 040781-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3841 (G1)
Quality Score218
Status Validated
Chromosome1
Chromosomal Location78497026-78512158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78497845 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 683 (N683K)
Ref Sequence ENSEMBL: ENSMUSP00000132488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170511]
Predicted Effect probably benign
Transcript: ENSMUST00000170511
AA Change: N683K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132488
Gene: ENSMUSG00000090486
AA Change: N683K

DomainStartEndE-ValueType
PDB:2M9U|A 43 87 3e-13 PDB
Pfam:TLV_coat 109 691 3.8e-147 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190853
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Atp8b3 A G 10: 80,529,706 F405L possibly damaging Het
Bmper T A 9: 23,473,431 probably null Het
Btnl7-ps A G 17: 34,542,576 noncoding transcript Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Dgcr6 C A 16: 18,070,213 Y200* probably null Het
Dsp A C 13: 38,197,705 I2210L probably benign Het
Eef1e1 G A 13: 38,656,191 T46I probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fbxw25 A T 9: 109,662,134 Y105* probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hipk2 T C 6: 38,818,926 E136G probably damaging Het
Hsph1 T A 5: 149,620,715 probably null Het
Impdh1 A G 6: 29,202,769 S421P probably damaging Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kmt2a T C 9: 44,831,291 probably benign Het
Ldlrap1 T C 4: 134,750,436 T159A probably damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Map3k10 C A 7: 27,658,364 C663F possibly damaging Het
Me3 A T 7: 89,786,493 N179Y possibly damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Olfr781 A G 10: 129,333,333 I151V probably benign Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Parp4 A T 14: 56,587,778 N120Y probably damaging Het
Ptprb T C 10: 116,346,982 V1521A possibly damaging Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Rcan2 A G 17: 44,036,979 K193R probably benign Het
Rdh19 A T 10: 127,856,886 M141L probably benign Het
Selenok C T 14: 29,973,380 R72* probably null Het
Tbpl1 A G 10: 22,711,908 probably benign Het
Tnxb A G 17: 34,698,923 E2270G possibly damaging Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Utp20 A T 10: 88,775,203 probably benign Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Zfp773 A G 7: 7,132,391 V402A possibly damaging Het
Other mutations in BC035947
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1853:BC035947 UTSW 1 78499016 missense possibly damaging 0.95
R2079:BC035947 UTSW 1 78511924 utr 5 prime probably benign
R2234:BC035947 UTSW 1 78497962 missense probably damaging 0.98
R2235:BC035947 UTSW 1 78497962 missense probably damaging 0.98
R3840:BC035947 UTSW 1 78497845 missense probably benign 0.00
R4804:BC035947 UTSW 1 78497876 missense probably damaging 1.00
R4909:BC035947 UTSW 1 78498029 missense probably damaging 0.99
R5139:BC035947 UTSW 1 78499247 missense possibly damaging 0.60
R5302:BC035947 UTSW 1 78511962 start codon destroyed probably null 0.00
R5669:BC035947 UTSW 1 78497913 missense probably damaging 0.98
R5686:BC035947 UTSW 1 78497930 missense probably benign 0.03
R5868:BC035947 UTSW 1 78498323 missense probably damaging 1.00
R5988:BC035947 UTSW 1 78499206 nonsense probably null
R6787:BC035947 UTSW 1 78498890 missense possibly damaging 0.64
R6854:BC035947 UTSW 1 78498488 missense probably damaging 1.00
R7079:BC035947 UTSW 1 78497915 missense probably damaging 1.00
R7168:BC035947 UTSW 1 78499593 missense probably benign 0.04
R7387:BC035947 UTSW 1 78498461 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGCAGTGGGCTCCTAGACAA -3'
(R):5'- AGACAAGGGATCCAGTCCTTA -3'

Sequencing Primer
(F):5'- AACCTGGAGTTTGACTGCATC -3'
(R):5'- GATCCAGTCCTTAAGAGATGCTG -3'
Posted On2015-04-06