Incidental Mutation 'R3841:C530008M17Rik'
ID277151
Institutional Source Beutler Lab
Gene Symbol C530008M17Rik
Ensembl Gene ENSMUSG00000036377
Gene NameRIKEN cDNA C530008M17 gene
Synonyms
MMRRC Submission 040781-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3841 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location76656512-76873554 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76859011 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1073 (Q1073L)
Ref Sequence ENSEMBL: ENSMUSP00000127212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120639] [ENSMUST00000121160] [ENSMUST00000163347]
Predicted Effect unknown
Transcript: ENSMUST00000120639
AA Change: Q1073L
SMART Domains Protein: ENSMUSP00000113796
Gene: ENSMUSG00000036377
AA Change: Q1073L

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121160
AA Change: Q1073L
SMART Domains Protein: ENSMUSP00000113947
Gene: ENSMUSG00000036377
AA Change: Q1073L

DomainStartEndE-ValueType
Pfam:DUF4592 45 172 1.8e-41 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 1034 1047 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152373
Predicted Effect unknown
Transcript: ENSMUST00000163347
AA Change: Q1073L
SMART Domains Protein: ENSMUSP00000127212
Gene: ENSMUSG00000036377
AA Change: Q1073L

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Atp8b3 A G 10: 80,529,706 F405L possibly damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
Bmper T A 9: 23,473,431 probably null Het
Btnl7-ps A G 17: 34,542,576 noncoding transcript Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Dgcr6 C A 16: 18,070,213 Y200* probably null Het
Dsp A C 13: 38,197,705 I2210L probably benign Het
Eef1e1 G A 13: 38,656,191 T46I probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fbxw25 A T 9: 109,662,134 Y105* probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hipk2 T C 6: 38,818,926 E136G probably damaging Het
Hsph1 T A 5: 149,620,715 probably null Het
Impdh1 A G 6: 29,202,769 S421P probably damaging Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kmt2a T C 9: 44,831,291 probably benign Het
Ldlrap1 T C 4: 134,750,436 T159A probably damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Map3k10 C A 7: 27,658,364 C663F possibly damaging Het
Me3 A T 7: 89,786,493 N179Y possibly damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Olfr781 A G 10: 129,333,333 I151V probably benign Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Parp4 A T 14: 56,587,778 N120Y probably damaging Het
Ptprb T C 10: 116,346,982 V1521A possibly damaging Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Rcan2 A G 17: 44,036,979 K193R probably benign Het
Rdh19 A T 10: 127,856,886 M141L probably benign Het
Selenok C T 14: 29,973,380 R72* probably null Het
Tbpl1 A G 10: 22,711,908 probably benign Het
Tnxb A G 17: 34,698,923 E2270G possibly damaging Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Utp20 A T 10: 88,775,203 probably benign Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Zfp773 A G 7: 7,132,391 V402A possibly damaging Het
Other mutations in C530008M17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:C530008M17Rik APN 5 76866056 unclassified probably benign
IGL00660:C530008M17Rik APN 5 76854933 critical splice acceptor site probably null
IGL00924:C530008M17Rik APN 5 76858986 missense unknown
IGL01025:C530008M17Rik APN 5 76658074 intron probably benign
IGL01122:C530008M17Rik APN 5 76870675 makesense probably null
IGL01393:C530008M17Rik APN 5 76858971 missense unknown
IGL01526:C530008M17Rik APN 5 76857631 missense unknown
IGL01986:C530008M17Rik APN 5 76858610 missense unknown
IGL02009:C530008M17Rik APN 5 76848970 missense possibly damaging 0.61
IGL02724:C530008M17Rik APN 5 76858459 missense unknown
IGL02869:C530008M17Rik APN 5 76859043 missense unknown
IGL03030:C530008M17Rik APN 5 76857616 missense unknown
IGL03150:C530008M17Rik APN 5 76867250 missense probably damaging 0.99
LCD18:C530008M17Rik UTSW 5 76658742 intron probably benign
R0975:C530008M17Rik UTSW 5 76856318 splice site probably benign
R1329:C530008M17Rik UTSW 5 76657932 intron probably benign
R1439:C530008M17Rik UTSW 5 76840910 missense probably damaging 0.99
R1750:C530008M17Rik UTSW 5 76857675 missense unknown
R1773:C530008M17Rik UTSW 5 76867205 missense possibly damaging 0.54
R1885:C530008M17Rik UTSW 5 76856742 missense unknown
R1924:C530008M17Rik UTSW 5 76858623 missense unknown
R2483:C530008M17Rik UTSW 5 76856409 missense probably damaging 0.98
R3840:C530008M17Rik UTSW 5 76859011 missense unknown
R3874:C530008M17Rik UTSW 5 76840892 missense probably damaging 1.00
R3883:C530008M17Rik UTSW 5 76856574 missense unknown
R4033:C530008M17Rik UTSW 5 76858465 missense unknown
R4401:C530008M17Rik UTSW 5 76848916 missense probably damaging 0.98
R4749:C530008M17Rik UTSW 5 76858834 missense unknown
R4884:C530008M17Rik UTSW 5 76848835 missense probably damaging 1.00
R4980:C530008M17Rik UTSW 5 76857574 missense unknown
R5010:C530008M17Rik UTSW 5 76657834 utr 5 prime probably benign
R5086:C530008M17Rik UTSW 5 76857124 missense unknown
R5468:C530008M17Rik UTSW 5 76840763 intron probably benign
R5786:C530008M17Rik UTSW 5 76866196 splice site probably null
R5813:C530008M17Rik UTSW 5 76858428 missense unknown
R5866:C530008M17Rik UTSW 5 76857537 missense unknown
R5928:C530008M17Rik UTSW 5 76841734 intron probably benign
R6273:C530008M17Rik UTSW 5 76857721 missense unknown
R6577:C530008M17Rik UTSW 5 76866100 unclassified probably benign
R6838:C530008M17Rik UTSW 5 76858209 missense unknown
R6849:C530008M17Rik UTSW 5 76857010 missense unknown
R6849:C530008M17Rik UTSW 5 76857157 missense unknown
R6914:C530008M17Rik UTSW 5 76857007 missense unknown
R7017:C530008M17Rik UTSW 5 76856948 small deletion probably benign
R7094:C530008M17Rik UTSW 5 76859032 missense unknown
R7367:C530008M17Rik UTSW 5 76856602 missense unknown
R7394:C530008M17Rik UTSW 5 76856954 small deletion probably benign
R7436:C530008M17Rik UTSW 5 76856954 small deletion probably benign
R7443:C530008M17Rik UTSW 5 76856638 missense unknown
R7500:C530008M17Rik UTSW 5 76658058 missense unknown
R7566:C530008M17Rik UTSW 5 76866275 intron probably null
R7633:C530008M17Rik UTSW 5 76857520 missense unknown
R7728:C530008M17Rik UTSW 5 76857469 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAAAATGCCATCCATGCAG -3'
(R):5'- GTGTTCCCAGAACCAGTTTCC -3'

Sequencing Primer
(F):5'- ATCCATGCAGAAGCCGGC -3'
(R):5'- AGAACCAGTTTCCCGTGGG -3'
Posted On2015-04-06