Incidental Mutation 'R3841:Zfp773'
ID277157
Institutional Source Beutler Lab
Gene Symbol Zfp773
Ensembl Gene ENSMUSG00000063535
Gene Namezinc finger protein 773
Synonyms2810409K11Rik
MMRRC Submission 040781-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R3841 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location7127073-7136755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7132391 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 402 (V402A)
Ref Sequence ENSEMBL: ENSMUSP00000032622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032622] [ENSMUST00000211240]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032622
AA Change: V402A

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032622
Gene: ENSMUSG00000063535
AA Change: V402A

DomainStartEndE-ValueType
KRAB 75 134 6.82e-8 SMART
ZnF_C2H2 241 263 1.31e0 SMART
ZnF_C2H2 269 291 1.5e-4 SMART
ZnF_C2H2 297 319 4.17e-3 SMART
ZnF_C2H2 325 347 2.05e-2 SMART
ZnF_C2H2 353 375 2.24e-3 SMART
ZnF_C2H2 381 403 8.81e-2 SMART
ZnF_C2H2 409 431 7.26e-3 SMART
ZnF_C2H2 437 459 7.26e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211240
Meta Mutation Damage Score 0.2561 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Atp8b3 A G 10: 80,529,706 F405L possibly damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
Bmper T A 9: 23,473,431 probably null Het
Btnl7-ps A G 17: 34,542,576 noncoding transcript Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Dgcr6 C A 16: 18,070,213 Y200* probably null Het
Dsp A C 13: 38,197,705 I2210L probably benign Het
Eef1e1 G A 13: 38,656,191 T46I probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fbxw25 A T 9: 109,662,134 Y105* probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hipk2 T C 6: 38,818,926 E136G probably damaging Het
Hsph1 T A 5: 149,620,715 probably null Het
Impdh1 A G 6: 29,202,769 S421P probably damaging Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kmt2a T C 9: 44,831,291 probably benign Het
Ldlrap1 T C 4: 134,750,436 T159A probably damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Map3k10 C A 7: 27,658,364 C663F possibly damaging Het
Me3 A T 7: 89,786,493 N179Y possibly damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Olfr781 A G 10: 129,333,333 I151V probably benign Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Parp4 A T 14: 56,587,778 N120Y probably damaging Het
Ptprb T C 10: 116,346,982 V1521A possibly damaging Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Rcan2 A G 17: 44,036,979 K193R probably benign Het
Rdh19 A T 10: 127,856,886 M141L probably benign Het
Selenok C T 14: 29,973,380 R72* probably null Het
Tbpl1 A G 10: 22,711,908 probably benign Het
Tnxb A G 17: 34,698,923 E2270G possibly damaging Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Utp20 A T 10: 88,775,203 probably benign Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in Zfp773
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Zfp773 APN 7 7132684 missense probably damaging 1.00
IGL00780:Zfp773 APN 7 7133114 missense probably benign 0.00
IGL01348:Zfp773 APN 7 7135315 missense possibly damaging 0.93
IGL02224:Zfp773 APN 7 7132976 missense probably benign 0.00
IGL02447:Zfp773 APN 7 7136656 utr 5 prime probably benign
IGL02869:Zfp773 APN 7 7134233 missense probably benign 0.22
R0505:Zfp773 UTSW 7 7133024 missense probably benign 0.03
R0585:Zfp773 UTSW 7 7132575 missense probably benign 0.21
R0804:Zfp773 UTSW 7 7133093 intron probably benign
R0846:Zfp773 UTSW 7 7132692 missense probably damaging 1.00
R1179:Zfp773 UTSW 7 7133093 intron probably benign
R2847:Zfp773 UTSW 7 7133093 intron probably benign
R4116:Zfp773 UTSW 7 7133093 intron probably benign
R4638:Zfp773 UTSW 7 7135336 missense probably damaging 1.00
R5126:Zfp773 UTSW 7 7136624 missense unknown
R6142:Zfp773 UTSW 7 7132482 missense probably benign 0.00
R7072:Zfp773 UTSW 7 7132875 missense probably benign 0.15
R7232:Zfp773 UTSW 7 7132985 missense probably benign 0.14
R7748:Zfp773 UTSW 7 7132908 missense probably benign 0.04
R7888:Zfp773 UTSW 7 7132979 missense probably benign 0.00
R7971:Zfp773 UTSW 7 7132979 missense probably benign 0.00
RF007:Zfp773 UTSW 7 7132690 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGCGTGAATCTTTCGGTG -3'
(R):5'- CCTTCATCCAAAAGACTGATCTG -3'

Sequencing Primer
(F):5'- GTCTAGAAAGTCCAGTCCTGTAGC -3'
(R):5'- CCTTGTTGGGCATCAAAGAC -3'
Posted On2015-04-06