Incidental Mutation 'R3842:Egf'
ID277193
Institutional Source Beutler Lab
Gene Symbol Egf
Ensembl Gene ENSMUSG00000028017
Gene Nameepidermal growth factor
Synonyms
MMRRC Submission 040782-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3842 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location129677565-129755316 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 129697793 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 351 (R351*)
Ref Sequence ENSEMBL: ENSMUSP00000142497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029653] [ENSMUST00000197079] [ENSMUST00000197713] [ENSMUST00000199615]
Predicted Effect probably null
Transcript: ENSMUST00000029653
AA Change: R852*
SMART Domains Protein: ENSMUSP00000029653
Gene: ENSMUSG00000028017
AA Change: R852*

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
LY 74 115 1.81e-3 SMART
LY 116 157 4.16e-3 SMART
LY 158 199 6.86e-4 SMART
LY 200 244 1.06e-4 SMART
EGF_like 330 361 7.86e-1 SMART
EGF_CA 362 402 2.4e-8 SMART
EGF 406 443 8.65e-1 SMART
EGF 444 483 5.79e-2 SMART
LY 510 552 1.1e-7 SMART
LY 553 595 4.32e-10 SMART
LY 596 639 6.05e-14 SMART
LY 640 682 2.89e-11 SMART
LY 683 724 1.3e-4 SMART
EGF 750 787 6.21e-2 SMART
EGF 841 876 9.13e0 SMART
EGF_CA 877 918 5.92e-8 SMART
EGF_like 919 959 3.56e-4 SMART
EGF 981 1019 2.79e-4 SMART
transmembrane domain 1039 1061 N/A INTRINSIC
low complexity region 1080 1099 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197079
AA Change: R351*
SMART Domains Protein: ENSMUSP00000143075
Gene: ENSMUSG00000028017
AA Change: R351*

DomainStartEndE-ValueType
LY 9 51 5.5e-10 SMART
LY 52 94 2.1e-12 SMART
LY 95 138 2.9e-16 SMART
LY 139 181 1.4e-13 SMART
LY 182 223 6.4e-7 SMART
EGF 249 286 3e-4 SMART
EGF 340 375 4.4e-2 SMART
EGF_CA 376 417 2.8e-10 SMART
EGF_like 418 458 1.7e-6 SMART
EGF 480 518 1.3e-6 SMART
transmembrane domain 538 560 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197713
SMART Domains Protein: ENSMUSP00000143108
Gene: ENSMUSG00000028017

DomainStartEndE-ValueType
LY 9 51 5.5e-10 SMART
LY 52 94 2.1e-12 SMART
LY 95 138 2.9e-16 SMART
LY 139 181 1.4e-13 SMART
LY 182 223 6.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199272
Predicted Effect probably null
Transcript: ENSMUST00000199615
AA Change: R351*
SMART Domains Protein: ENSMUSP00000142497
Gene: ENSMUSG00000028017
AA Change: R351*

DomainStartEndE-ValueType
LY 9 51 5.5e-10 SMART
LY 52 94 2.1e-12 SMART
LY 95 138 2.9e-16 SMART
LY 139 181 1.4e-13 SMART
LY 182 223 6.4e-7 SMART
EGF 249 286 3e-4 SMART
EGF 340 375 4.4e-2 SMART
EGF_CA 376 417 2.8e-10 SMART
EGF 439 477 1.3e-6 SMART
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 538 557 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene encodes epidermal growth factor (EGF), the founding member of the EGF family of growth factors that are implicated in cell proliferation and differentiation. The encoded protein can localize to the membrane and function in juxtacrine signaling or undergo proteolytic processing to generate a soluble form of the hormone. Mice lacking the encoded protein do not exhibit an abnormal phenotype but transgenic mice overexpressing the encoded protein exhibit hypospermatogenesis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants have normal phenotype. Females triply null, for this locus and the amphiregulin and transforming growth factor alpha genes, are unable to nurse due to impaired mammary gland development and show mild integument and digestive system anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 C T 14: 8,251,543 R318H probably damaging Het
Adamts16 T C 13: 70,738,891 Y958C possibly damaging Het
Apol7e A G 15: 77,717,589 E129G probably damaging Het
Bmp2k A G 5: 97,087,151 probably benign Het
Camk2g T C 14: 20,764,898 H26R probably damaging Het
Cpn2 A G 16: 30,260,518 S122P probably damaging Het
Dhcr24 G T 4: 106,585,805 G346C probably damaging Het
Exosc10 T A 4: 148,563,865 Y260* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Fbxo30 A G 10: 11,290,112 S193G probably damaging Het
Grik3 T C 4: 125,693,954 probably benign Het
Gtf3c6 A T 10: 40,254,321 probably null Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Hmgb2 T A 8: 57,513,354 S121T probably benign Het
Hyal2 T C 9: 107,572,121 S359P probably damaging Het
Itgbl1 A G 14: 123,840,565 T156A possibly damaging Het
Lrrk2 C A 15: 91,755,916 Q1555K probably benign Het
Myom1 T C 17: 71,045,624 V349A probably damaging Het
Naa40 A T 19: 7,229,809 probably benign Het
Ncam2 A G 16: 81,434,810 Y54C probably damaging Het
Nemf C T 12: 69,331,949 S533N probably damaging Het
Nkain1 T A 4: 130,537,296 I80F probably damaging Het
Olfr1335 A G 4: 118,809,255 V203A probably damaging Het
Olfr695 G A 7: 106,874,095 T50I probably benign Het
Olfr825 G A 10: 130,162,901 R142C probably benign Het
Pde3b T C 7: 114,526,867 S779P probably damaging Het
Prkar2a A G 9: 108,728,268 Y175C probably damaging Het
Slc44a5 T C 3: 154,261,394 probably benign Het
Smgc T A 15: 91,860,262 probably benign Het
Tasp1 T A 2: 139,951,501 S252C probably damaging Het
Tgfbrap1 A T 1: 43,059,154 Y489N probably damaging Het
Topors C T 4: 40,262,123 R387H probably benign Het
Ttn A G 2: 76,789,619 S15902P probably damaging Het
Ttn T C 2: 76,850,303 probably null Het
Other mutations in Egf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Egf APN 3 129711449 missense probably benign 0.01
IGL00579:Egf APN 3 129697798 missense probably benign 0.36
IGL01307:Egf APN 3 129739993 missense probably damaging 0.99
IGL01314:Egf APN 3 129686260 missense probably benign 0.16
IGL01360:Egf APN 3 129740020 missense probably damaging 1.00
IGL01367:Egf APN 3 129702455 critical splice donor site probably null
IGL01610:Egf APN 3 129706260 splice site probably benign
IGL01721:Egf APN 3 129697722 nonsense probably null
IGL01803:Egf APN 3 129736766 missense probably benign 0.09
IGL01866:Egf APN 3 129735880 missense probably benign 0.03
IGL02001:Egf APN 3 129716768 missense probably damaging 1.00
IGL02141:Egf APN 3 129739982 nonsense probably null
IGL02209:Egf APN 3 129707307 missense possibly damaging 0.93
IGL02347:Egf APN 3 129678377 missense probably benign 0.17
IGL02821:Egf APN 3 129702479 missense probably damaging 1.00
IGL02902:Egf APN 3 129681147 missense probably benign 0.34
IGL03114:Egf APN 3 129736880 missense probably damaging 0.98
PIT4151001:Egf UTSW 3 129702549 missense probably benign 0.00
R0200:Egf UTSW 3 129706233 missense probably benign 0.00
R0200:Egf UTSW 3 129737549 missense probably damaging 1.00
R0463:Egf UTSW 3 129706233 missense probably benign 0.00
R0463:Egf UTSW 3 129737549 missense probably damaging 1.00
R0507:Egf UTSW 3 129681179 missense possibly damaging 0.62
R0801:Egf UTSW 3 129702585 splice site probably benign
R1495:Egf UTSW 3 129713006 missense probably damaging 1.00
R1535:Egf UTSW 3 129690778 missense probably benign 0.00
R1626:Egf UTSW 3 129686215 missense possibly damaging 0.55
R1702:Egf UTSW 3 129690811 missense probably benign 0.17
R1906:Egf UTSW 3 129725224 missense probably benign 0.01
R2184:Egf UTSW 3 129723358 nonsense probably null
R3918:Egf UTSW 3 129696860 missense probably null 0.22
R4073:Egf UTSW 3 129735969 missense probably benign 0.01
R4074:Egf UTSW 3 129735969 missense probably benign 0.01
R4075:Egf UTSW 3 129735969 missense probably benign 0.01
R4307:Egf UTSW 3 129719095 missense probably damaging 0.99
R4321:Egf UTSW 3 129706134 missense probably damaging 1.00
R4617:Egf UTSW 3 129690793 missense probably benign 0.02
R4646:Egf UTSW 3 129720276 missense probably damaging 1.00
R4674:Egf UTSW 3 129718040 missense probably damaging 1.00
R4798:Egf UTSW 3 129716678 missense probably damaging 1.00
R4931:Egf UTSW 3 129711468 missense probably damaging 1.00
R4992:Egf UTSW 3 129711530 splice site probably null
R5166:Egf UTSW 3 129735840 missense probably benign
R5179:Egf UTSW 3 129686287 missense probably damaging 0.99
R5230:Egf UTSW 3 129718024 missense possibly damaging 0.95
R6043:Egf UTSW 3 129736785 missense probably benign 0.09
R6119:Egf UTSW 3 129736772 missense probably benign 0.00
R6493:Egf UTSW 3 129719088 start gained probably benign
R6639:Egf UTSW 3 129736832 missense probably benign 0.22
R6936:Egf UTSW 3 129681204 missense possibly damaging 0.95
R7019:Egf UTSW 3 129718064 splice site probably null
R7046:Egf UTSW 3 129754958 missense unknown
R7463:Egf UTSW 3 129740015 missense probably benign 0.39
R7472:Egf UTSW 3 129686263 missense possibly damaging 0.53
R7723:Egf UTSW 3 129706137 missense probably benign 0.00
R7920:Egf UTSW 3 129735840 missense probably benign
R7952:Egf UTSW 3 129739996 missense probably damaging 1.00
R8098:Egf UTSW 3 129690837 missense probably benign 0.09
R8344:Egf UTSW 3 129754943 missense unknown
R8557:Egf UTSW 3 129754951 missense unknown
R8912:Egf UTSW 3 129737515 missense possibly damaging 0.47
X0011:Egf UTSW 3 129711298 missense probably benign 0.19
Z1176:Egf UTSW 3 129697717 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAATATGCCCATGTGTCTCATTTCC -3'
(R):5'- TTCTGTTTGGAGGCTAGCCC -3'

Sequencing Primer
(F):5'- CCTACTAATTACTTACATCCTTGTGG -3'
(R):5'- TTTGGAGGCTAGCCCACACG -3'
Posted On2015-04-06