Incidental Mutation 'R3842:Slc44a5'
ID277194
Institutional Source Beutler Lab
Gene Symbol Slc44a5
Ensembl Gene ENSMUSG00000028360
Gene Namesolute carrier family 44, member 5
SynonymsLOC242259
MMRRC Submission 040782-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3842 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location153973436-154271722 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 154261394 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089948]
Predicted Effect probably benign
Transcript: ENSMUST00000089948
SMART Domains Protein: ENSMUSP00000087394
Gene: ENSMUSG00000028360

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 263 285 N/A INTRINSIC
Pfam:Choline_transpo 323 683 6.3e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144677
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 C T 14: 8,251,543 R318H probably damaging Het
Adamts16 T C 13: 70,738,891 Y958C possibly damaging Het
Apol7e A G 15: 77,717,589 E129G probably damaging Het
Bmp2k A G 5: 97,087,151 probably benign Het
Camk2g T C 14: 20,764,898 H26R probably damaging Het
Cpn2 A G 16: 30,260,518 S122P probably damaging Het
Dhcr24 G T 4: 106,585,805 G346C probably damaging Het
Egf G A 3: 129,697,793 R351* probably null Het
Exosc10 T A 4: 148,563,865 Y260* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Fbxo30 A G 10: 11,290,112 S193G probably damaging Het
Grik3 T C 4: 125,693,954 probably benign Het
Gtf3c6 A T 10: 40,254,321 probably null Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Hmgb2 T A 8: 57,513,354 S121T probably benign Het
Hyal2 T C 9: 107,572,121 S359P probably damaging Het
Itgbl1 A G 14: 123,840,565 T156A possibly damaging Het
Lrrk2 C A 15: 91,755,916 Q1555K probably benign Het
Myom1 T C 17: 71,045,624 V349A probably damaging Het
Naa40 A T 19: 7,229,809 probably benign Het
Ncam2 A G 16: 81,434,810 Y54C probably damaging Het
Nemf C T 12: 69,331,949 S533N probably damaging Het
Nkain1 T A 4: 130,537,296 I80F probably damaging Het
Olfr1335 A G 4: 118,809,255 V203A probably damaging Het
Olfr695 G A 7: 106,874,095 T50I probably benign Het
Olfr825 G A 10: 130,162,901 R142C probably benign Het
Pde3b T C 7: 114,526,867 S779P probably damaging Het
Prkar2a A G 9: 108,728,268 Y175C probably damaging Het
Smgc T A 15: 91,860,262 probably benign Het
Tasp1 T A 2: 139,951,501 S252C probably damaging Het
Tgfbrap1 A T 1: 43,059,154 Y489N probably damaging Het
Topors C T 4: 40,262,123 R387H probably benign Het
Ttn A G 2: 76,789,619 S15902P probably damaging Het
Ttn T C 2: 76,850,303 probably null Het
Other mutations in Slc44a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Slc44a5 APN 3 154262939 missense probably damaging 1.00
IGL02187:Slc44a5 APN 3 154262917 missense probably benign 0.00
IGL02219:Slc44a5 APN 3 154239159 missense possibly damaging 0.76
IGL02220:Slc44a5 APN 3 154250971 missense possibly damaging 0.94
IGL02314:Slc44a5 APN 3 154256519 missense probably damaging 1.00
IGL02471:Slc44a5 APN 3 154256576 missense probably damaging 1.00
IGL02869:Slc44a5 APN 3 154251014 missense probably damaging 0.97
IGL03117:Slc44a5 APN 3 154251077 missense probably benign 0.15
IGL03144:Slc44a5 APN 3 154243540 missense possibly damaging 0.78
PIT4486001:Slc44a5 UTSW 3 154259022 missense possibly damaging 0.50
R0026:Slc44a5 UTSW 3 154240270 splice site probably benign
R0190:Slc44a5 UTSW 3 154239118 missense probably null 0.00
R0306:Slc44a5 UTSW 3 154270001 missense probably damaging 1.00
R0591:Slc44a5 UTSW 3 154234145 splice site probably benign
R0744:Slc44a5 UTSW 3 154265474 missense probably damaging 1.00
R0833:Slc44a5 UTSW 3 154265474 missense probably damaging 1.00
R0919:Slc44a5 UTSW 3 154243586 missense probably damaging 1.00
R1170:Slc44a5 UTSW 3 154257720 intron probably null
R1370:Slc44a5 UTSW 3 154243159 missense probably benign 0.26
R1613:Slc44a5 UTSW 3 154257714 intron probably null
R1713:Slc44a5 UTSW 3 154239106 missense probably damaging 0.97
R1999:Slc44a5 UTSW 3 154258493 missense possibly damaging 0.61
R2143:Slc44a5 UTSW 3 154258449 missense probably benign 0.01
R2293:Slc44a5 UTSW 3 154240297 missense probably benign 0.01
R2367:Slc44a5 UTSW 3 154247809 missense possibly damaging 0.94
R3953:Slc44a5 UTSW 3 154171572 missense probably benign 0.03
R4163:Slc44a5 UTSW 3 154261373 missense possibly damaging 0.94
R4509:Slc44a5 UTSW 3 154234073 missense probably damaging 1.00
R4657:Slc44a5 UTSW 3 154256584 missense possibly damaging 0.81
R4936:Slc44a5 UTSW 3 154253716 missense probably damaging 1.00
R4937:Slc44a5 UTSW 3 154243615 critical splice donor site probably null
R5083:Slc44a5 UTSW 3 154247787 missense probably benign 0.31
R5257:Slc44a5 UTSW 3 154243123 missense probably damaging 1.00
R5580:Slc44a5 UTSW 3 154261285 missense probably benign 0.03
R5586:Slc44a5 UTSW 3 154270165 utr 3 prime probably benign
R5856:Slc44a5 UTSW 3 154258392 missense possibly damaging 0.78
R5894:Slc44a5 UTSW 3 154256573 missense probably damaging 1.00
R6228:Slc44a5 UTSW 3 154239163 missense probably benign 0.00
R6248:Slc44a5 UTSW 3 154264041 missense possibly damaging 0.93
R6413:Slc44a5 UTSW 3 154257750 missense probably benign 0.21
R6454:Slc44a5 UTSW 3 154243159 missense probably benign 0.26
R6594:Slc44a5 UTSW 3 154259023 missense possibly damaging 0.85
R6761:Slc44a5 UTSW 3 154240077 intron probably null
R6931:Slc44a5 UTSW 3 154258506 missense probably benign 0.03
R7027:Slc44a5 UTSW 3 154253719 missense probably benign 0.00
R7566:Slc44a5 UTSW 3 154269989 missense probably damaging 1.00
R7688:Slc44a5 UTSW 3 153973800 critical splice donor site probably null
R8011:Slc44a5 UTSW 3 154247810 missense possibly damaging 0.71
R8085:Slc44a5 UTSW 3 154222777 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTGATGTCATTGAGTCTG -3'
(R):5'- TCCCCTCAAATGTAATACTATCTCAAG -3'

Sequencing Primer
(F):5'- GGTTTTACTGCTGTGAACAGACACC -3'
(R):5'- CTCAAGAAAAGTGCAGCCCTGATTG -3'
Posted On2015-04-06