Incidental Mutation 'R3842:Topors'
ID277195
Institutional Source Beutler Lab
Gene Symbol Topors
Ensembl Gene ENSMUSG00000036822
Gene Nametopoisomerase I binding, arginine/serine-rich
Synonyms
MMRRC Submission 040782-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.543) question?
Stock #R3842 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location40259601-40269850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40262123 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 387 (R387H)
Ref Sequence ENSEMBL: ENSMUSP00000046843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042575]
Predicted Effect probably benign
Transcript: ENSMUST00000042575
AA Change: R387H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000046843
Gene: ENSMUSG00000036822
AA Change: R387H

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 29 44 N/A INTRINSIC
RING 104 142 7.27e-7 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 381 391 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 465 478 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 589 610 N/A INTRINSIC
low complexity region 620 696 N/A INTRINSIC
low complexity region 756 780 N/A INTRINSIC
low complexity region 837 860 N/A INTRINSIC
low complexity region 877 894 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein which is serine and arginine rich, and contains a RING-type zinc finger domain. It is highly expressed in the testis, and functions as an ubiquitin-protein E3 ligase. Mutations in this gene are associated with retinitis pigmentosa type 31. Alternatively spliced transcript variants, encoding different isoforms, have been observed for this locus. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 C T 14: 8,251,543 R318H probably damaging Het
Adamts16 T C 13: 70,738,891 Y958C possibly damaging Het
Apol7e A G 15: 77,717,589 E129G probably damaging Het
Bmp2k A G 5: 97,087,151 probably benign Het
Camk2g T C 14: 20,764,898 H26R probably damaging Het
Cpn2 A G 16: 30,260,518 S122P probably damaging Het
Dhcr24 G T 4: 106,585,805 G346C probably damaging Het
Egf G A 3: 129,697,793 R351* probably null Het
Exosc10 T A 4: 148,563,865 Y260* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Fbxo30 A G 10: 11,290,112 S193G probably damaging Het
Grik3 T C 4: 125,693,954 probably benign Het
Gtf3c6 A T 10: 40,254,321 probably null Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Hmgb2 T A 8: 57,513,354 S121T probably benign Het
Hyal2 T C 9: 107,572,121 S359P probably damaging Het
Itgbl1 A G 14: 123,840,565 T156A possibly damaging Het
Lrrk2 C A 15: 91,755,916 Q1555K probably benign Het
Myom1 T C 17: 71,045,624 V349A probably damaging Het
Naa40 A T 19: 7,229,809 probably benign Het
Ncam2 A G 16: 81,434,810 Y54C probably damaging Het
Nemf C T 12: 69,331,949 S533N probably damaging Het
Nkain1 T A 4: 130,537,296 I80F probably damaging Het
Olfr1335 A G 4: 118,809,255 V203A probably damaging Het
Olfr695 G A 7: 106,874,095 T50I probably benign Het
Olfr825 G A 10: 130,162,901 R142C probably benign Het
Pde3b T C 7: 114,526,867 S779P probably damaging Het
Prkar2a A G 9: 108,728,268 Y175C probably damaging Het
Slc44a5 T C 3: 154,261,394 probably benign Het
Smgc T A 15: 91,860,262 probably benign Het
Tasp1 T A 2: 139,951,501 S252C probably damaging Het
Tgfbrap1 A T 1: 43,059,154 Y489N probably damaging Het
Ttn A G 2: 76,789,619 S15902P probably damaging Het
Ttn T C 2: 76,850,303 probably null Het
Other mutations in Topors
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01450:Topors APN 4 40262417 missense probably damaging 1.00
IGL01541:Topors APN 4 40262364 missense possibly damaging 0.70
IGL02093:Topors APN 4 40261467 missense probably damaging 0.98
R0039:Topors UTSW 4 40262772 missense probably damaging 1.00
R0483:Topors UTSW 4 40261952 missense probably damaging 0.96
R0645:Topors UTSW 4 40260333 missense unknown
R1413:Topors UTSW 4 40261982 missense probably benign 0.01
R1507:Topors UTSW 4 40261829 missense probably damaging 0.99
R1677:Topors UTSW 4 40261776 missense probably damaging 0.99
R1863:Topors UTSW 4 40262149 nonsense probably null
R1960:Topors UTSW 4 40261044 missense unknown
R2035:Topors UTSW 4 40262879 missense probably damaging 1.00
R2155:Topors UTSW 4 40262790 missense possibly damaging 0.72
R2519:Topors UTSW 4 40261714 nonsense probably null
R3035:Topors UTSW 4 40269673 critical splice donor site probably null
R3037:Topors UTSW 4 40269673 critical splice donor site probably null
R4090:Topors UTSW 4 40260794 missense unknown
R4668:Topors UTSW 4 40262669 missense probably damaging 0.98
R4686:Topors UTSW 4 40261694 missense probably benign 0.03
R4694:Topors UTSW 4 40261442 missense possibly damaging 0.94
R4749:Topors UTSW 4 40261015 missense unknown
R5228:Topors UTSW 4 40262367 missense probably damaging 1.00
R5304:Topors UTSW 4 40262541 missense possibly damaging 0.50
R5725:Topors UTSW 4 40261952 missense probably damaging 0.96
R6617:Topors UTSW 4 40261896 nonsense probably null
R6699:Topors UTSW 4 40262300 missense probably damaging 0.97
R6869:Topors UTSW 4 40261201 missense unknown
R7103:Topors UTSW 4 40261706 missense probably benign 0.03
R7319:Topors UTSW 4 40260540 missense unknown
R7543:Topors UTSW 4 40268312 missense probably damaging 0.99
R7545:Topors UTSW 4 40262173 missense possibly damaging 0.91
R7559:Topors UTSW 4 40261401 missense unknown
R7748:Topors UTSW 4 40262654 missense probably damaging 1.00
R7899:Topors UTSW 4 40260356 missense unknown
R8045:Topors UTSW 4 40261988 missense probably benign 0.17
R8056:Topors UTSW 4 40262221 missense probably benign 0.30
R8221:Topors UTSW 4 40260686 missense unknown
Predicted Primers PCR Primer
(F):5'- GACAAGCTCTTCATCTGAACTGTC -3'
(R):5'- TATCGTCCAGCACATCATCATG -3'

Sequencing Primer
(F):5'- AGCTCTTCATCTGAACTGTCTGAAG -3'
(R):5'- GTCCAGCACATCATCATGAGTAATG -3'
Posted On2015-04-06