Incidental Mutation 'R3842:Grik3'
ID 277198
Institutional Source Beutler Lab
Gene Symbol Grik3
Ensembl Gene ENSMUSG00000001985
Gene Name glutamate receptor, ionotropic, kainate 3
Synonyms Glur7, Glur-7
MMRRC Submission 040782-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.280) question?
Stock # R3842 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 125490700-125714173 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 125693954 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030676]
AlphaFold B1AS29
Predicted Effect probably benign
Transcript: ENSMUST00000030676
SMART Domains Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985

DomainStartEndE-ValueType
Pfam:ANF_receptor 55 398 7.8e-72 PFAM
PBPe 435 802 4.38e-133 SMART
Lig_chan-Glu_bd 445 509 5.77e-34 SMART
transmembrane domain 823 845 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 C T 14: 8,251,543 R318H probably damaging Het
Adamts16 T C 13: 70,738,891 Y958C possibly damaging Het
Apol7e A G 15: 77,717,589 E129G probably damaging Het
Bmp2k A G 5: 97,087,151 probably benign Het
Camk2g T C 14: 20,764,898 H26R probably damaging Het
Cpn2 A G 16: 30,260,518 S122P probably damaging Het
Dhcr24 G T 4: 106,585,805 G346C probably damaging Het
Egf G A 3: 129,697,793 R351* probably null Het
Exosc10 T A 4: 148,563,865 Y260* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Fbxo30 A G 10: 11,290,112 S193G probably damaging Het
Gtf3c6 A T 10: 40,254,321 probably null Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Hmgb2 T A 8: 57,513,354 S121T probably benign Het
Hyal2 T C 9: 107,572,121 S359P probably damaging Het
Itgbl1 A G 14: 123,840,565 T156A possibly damaging Het
Lrrk2 C A 15: 91,755,916 Q1555K probably benign Het
Myom1 T C 17: 71,045,624 V349A probably damaging Het
Naa40 A T 19: 7,229,809 probably benign Het
Ncam2 A G 16: 81,434,810 Y54C probably damaging Het
Nemf C T 12: 69,331,949 S533N probably damaging Het
Nkain1 T A 4: 130,537,296 I80F probably damaging Het
Olfr1335 A G 4: 118,809,255 V203A probably damaging Het
Olfr695 G A 7: 106,874,095 T50I probably benign Het
Olfr825 G A 10: 130,162,901 R142C probably benign Het
Pde3b T C 7: 114,526,867 S779P probably damaging Het
Prkar2a A G 9: 108,728,268 Y175C probably damaging Het
Slc44a5 T C 3: 154,261,394 probably benign Het
Smgc T A 15: 91,860,262 probably benign Het
Tasp1 T A 2: 139,951,501 S252C probably damaging Het
Tgfbrap1 A T 1: 43,059,154 Y489N probably damaging Het
Topors C T 4: 40,262,123 R387H probably benign Het
Ttn A G 2: 76,789,619 S15902P probably damaging Het
Ttn T C 2: 76,850,303 probably null Het
Other mutations in Grik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Grik3 APN 4 125632415 missense probably benign
IGL01534:Grik3 APN 4 125686190 missense probably damaging 1.00
IGL01538:Grik3 APN 4 125694036 missense possibly damaging 0.90
IGL02276:Grik3 APN 4 125623502 missense possibly damaging 0.86
IGL02323:Grik3 APN 4 125685990 splice site probably benign
IGL02475:Grik3 APN 4 125650517 missense probably benign
IGL03198:Grik3 APN 4 125659762 missense probably benign 0.25
IGL03307:Grik3 APN 4 125641554 missense possibly damaging 0.91
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0116:Grik3 UTSW 4 125670556 missense probably benign 0.01
R0208:Grik3 UTSW 4 125686165 missense probably damaging 1.00
R0497:Grik3 UTSW 4 125623510 missense possibly damaging 0.82
R1295:Grik3 UTSW 4 125704564 splice site probably benign
R1296:Grik3 UTSW 4 125704564 splice site probably benign
R1515:Grik3 UTSW 4 125670728 missense probably benign 0.37
R1559:Grik3 UTSW 4 125707997 missense probably benign 0.16
R1617:Grik3 UTSW 4 125691192 missense probably benign
R1848:Grik3 UTSW 4 125694138 missense probably damaging 1.00
R2903:Grik3 UTSW 4 125670644 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R4649:Grik3 UTSW 4 125650485 missense probably damaging 1.00
R4841:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R4842:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R5093:Grik3 UTSW 4 125670589 missense probably benign
R5318:Grik3 UTSW 4 125694136 missense probably damaging 0.96
R5549:Grik3 UTSW 4 125686045 missense possibly damaging 0.95
R6221:Grik3 UTSW 4 125705123 missense probably damaging 0.99
R6226:Grik3 UTSW 4 125659789 missense probably benign 0.04
R6306:Grik3 UTSW 4 125632412 missense probably benign 0.01
R6672:Grik3 UTSW 4 125623516 missense probably benign 0.08
R6682:Grik3 UTSW 4 125650466 missense probably damaging 1.00
R6783:Grik3 UTSW 4 125632300 missense probably benign 0.01
R7390:Grik3 UTSW 4 125649739 missense probably damaging 1.00
R7604:Grik3 UTSW 4 125623635 missense probably damaging 0.97
R7790:Grik3 UTSW 4 125686019 missense probably damaging 1.00
R7822:Grik3 UTSW 4 125656397 critical splice donor site probably null
R7952:Grik3 UTSW 4 125704547 missense probably damaging 1.00
R8418:Grik3 UTSW 4 125686042 missense possibly damaging 0.95
R8769:Grik3 UTSW 4 125656373 missense probably damaging 1.00
R9030:Grik3 UTSW 4 125632392 missense probably benign 0.24
R9243:Grik3 UTSW 4 125707897 missense probably benign 0.00
R9792:Grik3 UTSW 4 125632522 missense probably damaging 0.97
R9793:Grik3 UTSW 4 125632522 missense probably damaging 0.97
Z1177:Grik3 UTSW 4 125650506 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAAGCTGAATACGCACGGC -3'
(R):5'- ACAGCACCGTACTCTATTTTGG -3'

Sequencing Primer
(F):5'- GTCTTGAGGTAGATCCAAGAATTTGC -3'
(R):5'- GTCTGCTTGGCCAGGTCATC -3'
Posted On 2015-04-06