Incidental Mutation 'R3842:Prkar2a'
ID277209
Institutional Source Beutler Lab
Gene Symbol Prkar2a
Ensembl Gene ENSMUSG00000032601
Gene Nameprotein kinase, cAMP dependent regulatory, type II alpha
Synonyms1110061A24Rik, RII(alpha)
MMRRC Submission 040782-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3842 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108689314-108750436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108728268 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 175 (Y175C)
Ref Sequence ENSEMBL: ENSMUSP00000141869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035220] [ENSMUST00000192344] [ENSMUST00000195405]
Predicted Effect probably damaging
Transcript: ENSMUST00000035220
AA Change: Y175C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035220
Gene: ENSMUSG00000032601
AA Change: Y175C

DomainStartEndE-ValueType
RIIa 8 45 7.15e-16 SMART
low complexity region 70 85 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
cNMP 137 257 2.27e-23 SMART
cNMP 259 384 2.02e-29 SMART
Predicted Effect unknown
Transcript: ENSMUST00000192068
AA Change: Y74C
Predicted Effect probably benign
Transcript: ENSMUST00000192344
Predicted Effect probably damaging
Transcript: ENSMUST00000195405
AA Change: Y175C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141869
Gene: ENSMUSG00000032601
AA Change: Y175C

DomainStartEndE-ValueType
RIIa 8 45 4.3e-18 SMART
low complexity region 70 85 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
cNMP 137 257 1.1e-25 SMART
cNMP 259 362 3.9e-12 SMART
Meta Mutation Damage Score 0.9677 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. It may interact with various A-kinase anchoring proteins and determine the subcellular localization of cAMP-dependent protein kinase. This subunit has been shown to regulate protein transport from endosomes to the Golgi apparatus and further to the endoplasmic reticulum (ER). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and appear healthy. They have normal growth and no deficits in locomotor activity, muscle strength, or exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 C T 14: 8,251,543 R318H probably damaging Het
Adamts16 T C 13: 70,738,891 Y958C possibly damaging Het
Apol7e A G 15: 77,717,589 E129G probably damaging Het
Bmp2k A G 5: 97,087,151 probably benign Het
Camk2g T C 14: 20,764,898 H26R probably damaging Het
Cpn2 A G 16: 30,260,518 S122P probably damaging Het
Dhcr24 G T 4: 106,585,805 G346C probably damaging Het
Egf G A 3: 129,697,793 R351* probably null Het
Exosc10 T A 4: 148,563,865 Y260* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Fbxo30 A G 10: 11,290,112 S193G probably damaging Het
Grik3 T C 4: 125,693,954 probably benign Het
Gtf3c6 A T 10: 40,254,321 probably null Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Hmgb2 T A 8: 57,513,354 S121T probably benign Het
Hyal2 T C 9: 107,572,121 S359P probably damaging Het
Itgbl1 A G 14: 123,840,565 T156A possibly damaging Het
Lrrk2 C A 15: 91,755,916 Q1555K probably benign Het
Myom1 T C 17: 71,045,624 V349A probably damaging Het
Naa40 A T 19: 7,229,809 probably benign Het
Ncam2 A G 16: 81,434,810 Y54C probably damaging Het
Nemf C T 12: 69,331,949 S533N probably damaging Het
Nkain1 T A 4: 130,537,296 I80F probably damaging Het
Olfr1335 A G 4: 118,809,255 V203A probably damaging Het
Olfr695 G A 7: 106,874,095 T50I probably benign Het
Olfr825 G A 10: 130,162,901 R142C probably benign Het
Pde3b T C 7: 114,526,867 S779P probably damaging Het
Slc44a5 T C 3: 154,261,394 probably benign Het
Smgc T A 15: 91,860,262 probably benign Het
Tasp1 T A 2: 139,951,501 S252C probably damaging Het
Tgfbrap1 A T 1: 43,059,154 Y489N probably damaging Het
Topors C T 4: 40,262,123 R387H probably benign Het
Ttn A G 2: 76,789,619 S15902P probably damaging Het
Ttn T C 2: 76,850,303 probably null Het
Other mutations in Prkar2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Prkar2a APN 9 108733204 missense possibly damaging 0.92
IGL02073:Prkar2a APN 9 108733123 missense probably damaging 0.99
IGL02117:Prkar2a APN 9 108719261 missense probably damaging 1.00
IGL02268:Prkar2a APN 9 108746953 missense probably benign 0.04
IGL02635:Prkar2a APN 9 108728277 missense probably damaging 0.99
IGL03006:Prkar2a APN 9 108740441 missense probably benign
PIT4486001:Prkar2a UTSW 9 108733127 missense probably damaging 1.00
R0335:Prkar2a UTSW 9 108719258 missense probably damaging 1.00
R0920:Prkar2a UTSW 9 108719297 splice site probably benign
R0943:Prkar2a UTSW 9 108733276 splice site probably benign
R1513:Prkar2a UTSW 9 108728270 missense possibly damaging 0.82
R2178:Prkar2a UTSW 9 108740538 critical splice donor site probably null
R3820:Prkar2a UTSW 9 108746956 missense probably damaging 1.00
R4807:Prkar2a UTSW 9 108740385 intron probably benign
R4886:Prkar2a UTSW 9 108745624 critical splice donor site probably null
R5051:Prkar2a UTSW 9 108745491 missense probably benign 0.00
R5435:Prkar2a UTSW 9 108740483 missense probably damaging 1.00
R6979:Prkar2a UTSW 9 108733143 missense possibly damaging 0.76
R7121:Prkar2a UTSW 9 108692622 missense probably benign
R7199:Prkar2a UTSW 9 108740470 missense probably damaging 1.00
R7819:Prkar2a UTSW 9 108745545 missense probably damaging 1.00
R8194:Prkar2a UTSW 9 108692511 missense probably damaging 1.00
R8218:Prkar2a UTSW 9 108719249 missense possibly damaging 0.83
R8253:Prkar2a UTSW 9 108740439 missense probably damaging 1.00
X0060:Prkar2a UTSW 9 108745582 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAAAGGGTGTACACTGCC -3'
(R):5'- CTCCCAAACAGGAATTTTACTCAGG -3'

Sequencing Primer
(F):5'- CACGCAGACTGCCCATTATATTTTC -3'
(R):5'- TTTACTCAGGACTCTCAGGACAG -3'
Posted On2015-04-06