Mutagenetix > Incidental Mutation

Incidental Mutation 'R3842:Myom1'

277225

Institutional Source

Beutler Lab

Gene Symbol

Myom1

Ensembl Gene

ENSMUSG00000024049

Gene Name

myomesin 1

Synonyms

skelemin, D430047A17Rik

MMRRC Submission

040782-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3842 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71019521-71126856 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 71045624 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 349 (V349A)

Ref Sequence

ENSEMBL: ENSMUSP00000136266 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]

AlphaFold

Q62234

Predicted Effect

possibly damaging
Transcript: ENSMUST00000024847
AA Change: V349A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: V349A

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000073211
AA Change: V349A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: V349A

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
low complexity region	857	870	N/A	INTRINSIC
FN3	916	1002	4.99e-11	SMART
FN3	1021	1106	2.04e-16	SMART
IG	1123	1208	3.1e0	SMART
IG_like	1231	1317	1.34e1	SMART
IG_like	1351	1417	4.79e0	SMART
IG_like	1454	1531	1.54e2	SMART
IGc2	1567	1635	2.05e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000179759
AA Change: V349A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: V349A

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180743

Meta Mutation Damage Score

0.4260

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	C	T	14: 8,251,543	R318H	probably damaging	Het
Adamts16	T	C	13: 70,738,891	Y958C	possibly damaging	Het
Apol7e	A	G	15: 77,717,589	E129G	probably damaging	Het
Bmp2k	A	G	5: 97,087,151		probably benign	Het
Camk2g	T	C	14: 20,764,898	H26R	probably damaging	Het
Cpn2	A	G	16: 30,260,518	S122P	probably damaging	Het
Dhcr24	G	T	4: 106,585,805	G346C	probably damaging	Het
Egf	G	A	3: 129,697,793	R351*	probably null	Het
Exosc10	T	A	4: 148,563,865	Y260*	probably null	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam83h	C	T	15: 76,002,650	R946K	probably benign	Het
Fbxo30	A	G	10: 11,290,112	S193G	probably damaging	Het
Grik3	T	C	4: 125,693,954		probably benign	Het
Gtf3c6	A	T	10: 40,254,321		probably null	Het
Hivep1	T	C	13: 42,157,727	S1148P	probably benign	Het
Hmgb2	T	A	8: 57,513,354	S121T	probably benign	Het
Hyal2	T	C	9: 107,572,121	S359P	probably damaging	Het
Itgbl1	A	G	14: 123,840,565	T156A	possibly damaging	Het
Lrrk2	C	A	15: 91,755,916	Q1555K	probably benign	Het
Naa40	A	T	19: 7,229,809		probably benign	Het
Ncam2	A	G	16: 81,434,810	Y54C	probably damaging	Het
Nemf	C	T	12: 69,331,949	S533N	probably damaging	Het
Nkain1	T	A	4: 130,537,296	I80F	probably damaging	Het
Olfr1335	A	G	4: 118,809,255	V203A	probably damaging	Het
Olfr695	G	A	7: 106,874,095	T50I	probably benign	Het
Olfr825	G	A	10: 130,162,901	R142C	probably benign	Het
Pde3b	T	C	7: 114,526,867	S779P	probably damaging	Het
Prkar2a	A	G	9: 108,728,268	Y175C	probably damaging	Het
Slc44a5	T	C	3: 154,261,394		probably benign	Het
Smgc	T	A	15: 91,860,262		probably benign	Het
Tasp1	T	A	2: 139,951,501	S252C	probably damaging	Het
Tgfbrap1	A	T	1: 43,059,154	Y489N	probably damaging	Het
Topors	C	T	4: 40,262,123	R387H	probably benign	Het
Ttn	A	G	2: 76,789,619	S15902P	probably damaging	Het
Ttn	T	C	2: 76,850,303		probably null	Het

Other mutations in Myom1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Myom1	APN	17	71126098	missense	probably damaging	1.00
IGL00845:Myom1	APN	17	71084429	missense	probably damaging	1.00
IGL00904:Myom1	APN	17	71099949	splice site	probably benign
IGL00928:Myom1	APN	17	71089913	missense	probably damaging	1.00
IGL01025:Myom1	APN	17	71077917	missense	probably damaging	1.00
IGL01548:Myom1	APN	17	71101220	splice site	probably benign
IGL01588:Myom1	APN	17	71117437	missense	possibly damaging	0.94
IGL01614:Myom1	APN	17	71126178	missense	possibly damaging	0.46
IGL01618:Myom1	APN	17	71099993	missense	possibly damaging	0.87
IGL01619:Myom1	APN	17	71044476	splice site	probably benign
IGL01766:Myom1	APN	17	71077288	missense	probably damaging	1.00
IGL02105:Myom1	APN	17	71047716	splice site	probably benign
IGL02122:Myom1	APN	17	71092137	missense	probably damaging	1.00
IGL02184:Myom1	APN	17	71072137	missense	possibly damaging	0.93
IGL02260:Myom1	APN	17	71108315	nonsense	probably null
IGL02486:Myom1	APN	17	71099944	splice site	probably benign
IGL02501:Myom1	APN	17	71072081	critical splice acceptor site	probably null
IGL02642:Myom1	APN	17	71101098	missense	possibly damaging	0.90
IGL02677:Myom1	APN	17	71084349	missense	probably damaging	1.00
IGL02719:Myom1	APN	17	71106354	splice site	probably benign
IGL02945:Myom1	APN	17	71092093	splice site	probably benign
IGL03086:Myom1	APN	17	71108671	missense	probably damaging	1.00
IGL03218:Myom1	APN	17	71084316	missense	possibly damaging	0.46
R0107:Myom1	UTSW	17	71077365	missense	probably damaging	1.00
R0130:Myom1	UTSW	17	71045755	missense	probably damaging	0.98
R0133:Myom1	UTSW	17	71047787	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0352:Myom1	UTSW	17	71045749	missense	possibly damaging	0.72
R0396:Myom1	UTSW	17	71034693	missense	probably damaging	1.00
R0496:Myom1	UTSW	17	71084306	missense	probably damaging	1.00
R0506:Myom1	UTSW	17	71092220	splice site	probably benign
R0511:Myom1	UTSW	17	71084317	missense	probably benign	0.22
R0600:Myom1	UTSW	17	71120648	missense	possibly damaging	0.48
R0699:Myom1	UTSW	17	71067313	missense	probably damaging	0.98
R0791:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0792:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0963:Myom1	UTSW	17	71077767	missense	possibly damaging	0.74
R1324:Myom1	UTSW	17	71052719	missense	probably damaging	0.98
R2102:Myom1	UTSW	17	71101029	missense	probably damaging	1.00
R2158:Myom1	UTSW	17	71064597	missense	possibly damaging	0.83
R2336:Myom1	UTSW	17	71023194	missense	possibly damaging	0.53
R2351:Myom1	UTSW	17	71034579	missense	probably damaging	0.98
R2442:Myom1	UTSW	17	71110735	missense	probably damaging	1.00
R2483:Myom1	UTSW	17	71077812	missense	probably damaging	1.00
R2892:Myom1	UTSW	17	71034653	missense	probably damaging	1.00
R2897:Myom1	UTSW	17	71101220	splice site	probably benign
R3440:Myom1	UTSW	17	71045663	splice site	probably null
R4249:Myom1	UTSW	17	71092140	missense	probably damaging	1.00
R4329:Myom1	UTSW	17	71036353	missense	probably damaging	1.00
R4594:Myom1	UTSW	17	71100074	missense	possibly damaging	0.73
R4873:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4875:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4876:Myom1	UTSW	17	71077410	missense	probably damaging	1.00
R5171:Myom1	UTSW	17	71099972	missense	possibly damaging	0.94
R5540:Myom1	UTSW	17	71109787	missense	probably damaging	1.00
R5882:Myom1	UTSW	17	71110722	missense	probably damaging	1.00
R5978:Myom1	UTSW	17	71117443	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6155:Myom1	UTSW	17	71108695	critical splice donor site	probably null
R6261:Myom1	UTSW	17	71126137	missense	probably damaging	1.00
R6284:Myom1	UTSW	17	71022892	nonsense	probably null
R6313:Myom1	UTSW	17	71082488	missense	probably benign
R6369:Myom1	UTSW	17	71101076	missense	probably damaging	1.00
R6545:Myom1	UTSW	17	71082305	missense	probably benign	0.00
R6738:Myom1	UTSW	17	71100398	splice site	probably null
R6933:Myom1	UTSW	17	71052671	missense	probably damaging	1.00
R7168:Myom1	UTSW	17	71089947	missense	probably benign	0.00
R7286:Myom1	UTSW	17	71045549	missense	possibly damaging	0.90
R7315:Myom1	UTSW	17	71080897	critical splice donor site	probably null
R7672:Myom1	UTSW	17	71084240	missense	possibly damaging	0.92
R7789:Myom1	UTSW	17	71117436	missense	probably benign	0.03
R7898:Myom1	UTSW	17	71045752	missense	probably benign	0.25
R8008:Myom1	UTSW	17	71100062	missense	probably benign	0.30
R8152:Myom1	UTSW	17	71084295	missense	probably damaging	0.96
R8554:Myom1	UTSW	17	71036453	missense	possibly damaging	0.94
R8874:Myom1	UTSW	17	71106204	missense	probably damaging	1.00
R8981:Myom1	UTSW	17	71084321	missense	probably benign	0.09
R9012:Myom1	UTSW	17	71100108	missense	probably benign	0.06
R9090:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9193:Myom1	UTSW	17	71036300	missense	probably damaging	1.00
R9237:Myom1	UTSW	17	71101056	missense	probably damaging	1.00
R9271:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9355:Myom1	UTSW	17	71077893	missense	probably damaging	1.00
R9362:Myom1	UTSW	17	71036293	missense	probably benign	0.00
R9440:Myom1	UTSW	17	71126334	missense	probably benign	0.00
R9469:Myom1	UTSW	17	71061127	missense	possibly damaging	0.79
R9568:Myom1	UTSW	17	71087481	missense	probably damaging	1.00
R9612:Myom1	UTSW	17	71105480	nonsense	probably null
R9645:Myom1	UTSW	17	71092209	missense	probably benign	0.01
X0019:Myom1	UTSW	17	71100071	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- TCCTAAAGAGCCATGTGTGAACC -3'
(R):5'- CAATGCTCTGTGAAACTTACAGC -3'

Sequencing Primer
(F):5'- GCCATGTGTGAACCATTAATTTCTG -3'
(R):5'- TGCTCTGTGAAACTTACAGCTGAGAG -3'

Posted On

2015-04-06