Incidental Mutation 'R3843:Olfr1032'
ID277232
Institutional Source Beutler Lab
Gene Symbol Olfr1032
Ensembl Gene ENSMUSG00000042796
Gene Nameolfactory receptor 1032
SynonymsGA_x6K02T2Q125-47485813-47486745, MOR199-1
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86005540-86009125 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86008204 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 143 (I143V)
Ref Sequence ENSEMBL: ENSMUSP00000107216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062166] [ENSMUST00000079298] [ENSMUST00000111589]
Predicted Effect probably benign
Transcript: ENSMUST00000062166
AA Change: I143V

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000054494
Gene: ENSMUSG00000042796
AA Change: I143V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.6e-50 PFAM
Pfam:7tm_1 39 288 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079298
AA Change: I143V

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000078279
Gene: ENSMUSG00000042796
AA Change: I143V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.3e-50 PFAM
Pfam:7tm_1 39 288 9.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111589
AA Change: I143V

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000107216
Gene: ENSMUSG00000042796
AA Change: I143V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.4e-50 PFAM
Pfam:7tm_1 39 288 3.5e-21 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Olfr1032
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Olfr1032 APN 2 86008547 missense probably damaging 1.00
IGL03110:Olfr1032 APN 2 86008598 missense probably damaging 0.99
IGL03167:Olfr1032 APN 2 86008167 nonsense probably null
R0206:Olfr1032 UTSW 2 86008292 missense probably damaging 1.00
R0206:Olfr1032 UTSW 2 86008292 missense probably damaging 1.00
R0919:Olfr1032 UTSW 2 86008640 missense possibly damaging 0.52
R2018:Olfr1032 UTSW 2 86008223 missense probably damaging 1.00
R2019:Olfr1032 UTSW 2 86008223 missense probably damaging 1.00
R2938:Olfr1032 UTSW 2 86008013 missense probably damaging 0.97
R4295:Olfr1032 UTSW 2 86008270 missense probably benign 0.01
R5813:Olfr1032 UTSW 2 86008292 missense probably damaging 1.00
R6283:Olfr1032 UTSW 2 86008099 missense possibly damaging 0.73
R7031:Olfr1032 UTSW 2 86008595 missense probably benign 0.26
R7427:Olfr1032 UTSW 2 86008219 missense probably benign 0.00
R7428:Olfr1032 UTSW 2 86008219 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAATGTCACTCCTAAAATGCTAG -3'
(R):5'- ATGTGAAGTTAATGCCTGCAAG -3'

Sequencing Primer
(F):5'- TGTCACTCCTAAAATGCTAGAAAAC -3'
(R):5'- TGAAGTTAATGCCTGCAAGTATAATC -3'
Posted On2015-04-06