Incidental Mutation 'R3843:Lgr4'
ID277233
Institutional Source Beutler Lab
Gene Symbol Lgr4
Ensembl Gene ENSMUSG00000050199
Gene Nameleucine-rich repeat-containing G protein-coupled receptor 4
SynonymsA930009A08Rik, Gpr48, A330106J01Rik
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location109917647-110014257 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 109996773 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046548] [ENSMUST00000111037]
Predicted Effect probably benign
Transcript: ENSMUST00000046548
SMART Domains Protein: ENSMUSP00000047325
Gene: ENSMUSG00000050199

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 28 61 6.68e-6 SMART
LRR 55 79 1.49e1 SMART
LRR 80 103 1.99e0 SMART
LRR_TYP 104 127 2.75e-3 SMART
LRR_TYP 128 151 2.79e-4 SMART
LRR 152 175 2.54e1 SMART
LRR 176 199 4.65e-1 SMART
LRR_TYP 200 223 1.04e-3 SMART
LRR 224 246 6.4e0 SMART
LRR_TYP 247 270 5.99e-4 SMART
LRR 272 294 9.77e1 SMART
LRR 318 341 3e1 SMART
LRR 343 363 4.71e1 SMART
LRR 364 387 1.49e1 SMART
LRR_TYP 388 411 1.15e-5 SMART
LRR 412 435 3.98e1 SMART
low complexity region 500 516 N/A INTRINSIC
Pfam:7tm_1 555 801 2.7e-10 PFAM
low complexity region 824 837 N/A INTRINSIC
low complexity region 910 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111037
SMART Domains Protein: ENSMUSP00000106666
Gene: ENSMUSG00000050199

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 28 61 6.68e-6 SMART
LRR 55 79 9.77e1 SMART
LRR_TYP 80 103 2.75e-3 SMART
LRR_TYP 104 127 2.79e-4 SMART
LRR 128 151 2.54e1 SMART
LRR 152 175 4.65e-1 SMART
LRR_TYP 176 199 1.04e-3 SMART
LRR 200 222 6.4e0 SMART
LRR_TYP 223 246 5.99e-4 SMART
LRR 248 270 9.77e1 SMART
LRR 294 317 3e1 SMART
LRR 319 339 4.71e1 SMART
LRR 340 363 1.49e1 SMART
LRR_TYP 364 387 1.15e-5 SMART
LRR 388 411 3.98e1 SMART
low complexity region 476 492 N/A INTRINSIC
Pfam:7tm_1 531 777 9.3e-17 PFAM
low complexity region 800 813 N/A INTRINSIC
low complexity region 886 900 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152584
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor that binds R-spondins and activates the Wnt signaling pathway. This Wnt signaling pathway activation is necessary for proper development of many organs of the body. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a knock-out allele show embryonic and perinatal death, open eyelids, and abnormal renal development. One gene trap mutation leads to reduced body weight, sterility, and impaired male reproductive tract development. Another gene trap mutation causes ocular anterior segment anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Lgr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Lgr4 APN 2 110011290 missense probably damaging 1.00
IGL02247:Lgr4 APN 2 110002501 missense probably benign
IGL02247:Lgr4 APN 2 110008075 splice site probably benign
IGL02302:Lgr4 APN 2 110002496 missense probably damaging 0.99
IGL02309:Lgr4 APN 2 110012535 utr 3 prime probably benign
IGL02511:Lgr4 APN 2 110011272 missense probably benign 0.06
IGL02604:Lgr4 APN 2 110011313 missense probably damaging 1.00
IGL02648:Lgr4 APN 2 110012373 missense probably damaging 1.00
IGL02795:Lgr4 APN 2 110008210 splice site probably benign
IGL02899:Lgr4 APN 2 109918253 missense probably damaging 0.99
R0003:Lgr4 UTSW 2 109997665 critical splice donor site probably null
R0200:Lgr4 UTSW 2 109970690 critical splice acceptor site probably null
R0314:Lgr4 UTSW 2 109991093 splice site probably benign
R0482:Lgr4 UTSW 2 110008092 missense probably damaging 1.00
R0491:Lgr4 UTSW 2 110007281 splice site probably benign
R0517:Lgr4 UTSW 2 110011320 missense probably damaging 1.00
R0546:Lgr4 UTSW 2 109999421 missense probably damaging 0.98
R0658:Lgr4 UTSW 2 110011787 missense possibly damaging 0.83
R1367:Lgr4 UTSW 2 109991135 missense probably damaging 0.98
R1864:Lgr4 UTSW 2 110011397 missense possibly damaging 0.93
R1977:Lgr4 UTSW 2 110011928 missense probably damaging 1.00
R2239:Lgr4 UTSW 2 110012393 missense probably damaging 1.00
R2380:Lgr4 UTSW 2 110012393 missense probably damaging 1.00
R2383:Lgr4 UTSW 2 110000615 missense probably damaging 1.00
R2997:Lgr4 UTSW 2 110003517 missense probably benign 0.30
R3707:Lgr4 UTSW 2 109970754 missense probably damaging 0.99
R3803:Lgr4 UTSW 2 110008197 missense probably benign 0.10
R3804:Lgr4 UTSW 2 110008197 missense probably benign 0.10
R4030:Lgr4 UTSW 2 109989751 missense probably benign 0.06
R4513:Lgr4 UTSW 2 110012016 missense possibly damaging 0.93
R4777:Lgr4 UTSW 2 109996682 missense probably damaging 0.98
R4912:Lgr4 UTSW 2 110006502 critical splice acceptor site probably null
R4994:Lgr4 UTSW 2 110011938 missense probably damaging 0.99
R5106:Lgr4 UTSW 2 109997595 missense probably damaging 0.97
R5131:Lgr4 UTSW 2 110012333 missense probably benign
R5152:Lgr4 UTSW 2 110000603 missense probably damaging 1.00
R5753:Lgr4 UTSW 2 110002512 nonsense probably null
R5860:Lgr4 UTSW 2 109991151 missense probably damaging 0.96
R5914:Lgr4 UTSW 2 109918272 missense possibly damaging 0.78
R6145:Lgr4 UTSW 2 110007243 nonsense probably null
R6263:Lgr4 UTSW 2 110011898 missense possibly damaging 0.95
R6400:Lgr4 UTSW 2 109991133 missense probably damaging 0.98
R6924:Lgr4 UTSW 2 110012439 missense probably damaging 1.00
R7171:Lgr4 UTSW 2 110000969 missense probably benign 0.11
R7326:Lgr4 UTSW 2 109996629 nonsense probably null
R7593:Lgr4 UTSW 2 109999456 missense probably damaging 1.00
R7659:Lgr4 UTSW 2 109996766 missense probably damaging 1.00
R7707:Lgr4 UTSW 2 109997591 critical splice acceptor site probably null
X0053:Lgr4 UTSW 2 110011437 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GACAGTTTTGAAGGGCTCGTTC -3'
(R):5'- CTTATTGTTGGGACAGAAACAGAAG -3'

Sequencing Primer
(F):5'- GCTCGTTCAGTTGCGGCATC -3'
(R):5'- TGTTGGGACAGAAACAGAAGTTATAC -3'
Posted On2015-04-06