Incidental Mutation 'R3843:E2f1'
ID277234
Institutional Source Beutler Lab
Gene Symbol E2f1
Ensembl Gene ENSMUSG00000027490
Gene NameE2F transcription factor 1
SynonymsE2F-1
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.759) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154559407-154569892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154560828 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 340 (S340P)
Ref Sequence ENSEMBL: ENSMUSP00000000894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000894] [ENSMUST00000000895] [ENSMUST00000103145] [ENSMUST00000109716] [ENSMUST00000125793]
Predicted Effect probably benign
Transcript: ENSMUST00000000894
AA Change: S340P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000000894
Gene: ENSMUSG00000027490
AA Change: S340P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:E2F_TDP 77 142 1.1e-25 PFAM
low complexity region 156 173 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000000895
SMART Domains Protein: ENSMUSP00000000895
Gene: ENSMUSG00000027489

DomainStartEndE-ValueType
Pfam:EF-hand_1 31 58 7.3e-8 PFAM
Pfam:EF-hand_5 32 57 4.6e-9 PFAM
low complexity region 180 203 N/A INTRINSIC
coiled coil region 209 237 N/A INTRINSIC
Pfam:ABM 252 327 4.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103145
AA Change: S385P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099434
Gene: ENSMUSG00000027490
AA Change: S385P

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
E2F_TDP 122 187 1.63e-30 SMART
Pfam:E2F_CC-MB 201 294 2.2e-37 PFAM
low complexity region 318 340 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109716
SMART Domains Protein: ENSMUSP00000105338
Gene: ENSMUSG00000027489

DomainStartEndE-ValueType
Pfam:EF-hand_1 31 59 6.9e-8 PFAM
Pfam:EF-hand_5 32 57 1.7e-9 PFAM
low complexity region 180 203 N/A INTRINSIC
Pfam:ABM 232 303 2.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124382
Predicted Effect probably benign
Transcript: ENSMUST00000125793
SMART Domains Protein: ENSMUSP00000117090
Gene: ENSMUSG00000027489

DomainStartEndE-ValueType
low complexity region 146 168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149725
Meta Mutation Damage Score 0.0713 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F2 and E2F3, have an additional cyclin binding domain. This protein binds preferentially to retinoblastoma protein pRB in a cell-cycle dependent manner. It can mediate both cell proliferation and p53-dependent/independent apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show defective T lymphocyte development, impaired pancreatic growth and beta cell function, altered glucose homeostasis, testicular atrophy, salivary gland and adipose tissue defects, and increased tumor induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in E2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0666:E2f1 UTSW 2 154560929 missense probably benign 0.01
R0674:E2f1 UTSW 2 154564109 missense probably damaging 1.00
R1796:E2f1 UTSW 2 154560929 missense probably benign 0.02
R3747:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3751:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3752:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3753:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3844:E2f1 UTSW 2 154560828 missense probably benign 0.00
R3968:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3969:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R3970:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R4409:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R4700:E2f1 UTSW 2 154564022 missense probably damaging 1.00
R5396:E2f1 UTSW 2 154564448 missense probably benign 0.00
R5666:E2f1 UTSW 2 154569181 intron probably benign
R6368:E2f1 UTSW 2 154564476 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCTATTCCAATGAGGCAGGAAG -3'
(R):5'- TATTTGGCAGGCACTCATGG -3'

Sequencing Primer
(F):5'- AGACAGGTGGGCATCTCCAG -3'
(R):5'- ACTCATGGCAGCCCCTC -3'
Posted On2015-04-06