Incidental Mutation 'R3843:Slc50a1'
ID277236
Institutional Source Beutler Lab
Gene Symbol Slc50a1
Ensembl Gene ENSMUSG00000027953
Gene Namesolute carrier family 50 (sugar transporter), member 1
SynonymsRag1ap1, Rga
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89268246-89270570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89269900 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 70 (I70N)
Ref Sequence ENSEMBL: ENSMUSP00000103084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029565] [ENSMUST00000029566] [ENSMUST00000040824] [ENSMUST00000107460] [ENSMUST00000107462] [ENSMUST00000118587] [ENSMUST00000118860] [ENSMUST00000130230] [ENSMUST00000185119]
Predicted Effect probably damaging
Transcript: ENSMUST00000029565
AA Change: I70N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029565
Gene: ENSMUSG00000027953
AA Change: I70N

DomainStartEndE-ValueType
Pfam:MtN3_slv 9 95 2.3e-32 PFAM
transmembrane domain 96 118 N/A INTRINSIC
Pfam:MtN3_slv 127 213 7e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029566
SMART Domains Protein: ENSMUSP00000029566
Gene: ENSMUSG00000027954

DomainStartEndE-ValueType
Pfam:Ephrin 18 147 1.2e-45 PFAM
low complexity region 187 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040824
SMART Domains Protein: ENSMUSP00000040860
Gene: ENSMUSG00000042737

DomainStartEndE-ValueType
Pfam:DPM3 1 92 2.3e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107460
AA Change: I70N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103084
Gene: ENSMUSG00000027953
AA Change: I70N

DomainStartEndE-ValueType
Pfam:MtN3_slv 9 95 4.5e-33 PFAM
Pfam:MtN3_slv 92 159 6.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107462
SMART Domains Protein: ENSMUSP00000103086
Gene: ENSMUSG00000042737

DomainStartEndE-ValueType
Pfam:DPM3 1 91 3.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118587
SMART Domains Protein: ENSMUSP00000112904
Gene: ENSMUSG00000027954

DomainStartEndE-ValueType
Pfam:Ephrin 1 90 2.2e-34 PFAM
low complexity region 124 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118860
SMART Domains Protein: ENSMUSP00000113098
Gene: ENSMUSG00000027954

DomainStartEndE-ValueType
Pfam:Ephrin 15 153 1.4e-58 PFAM
low complexity region 165 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130230
AA Change: I38N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123276
Gene: ENSMUSG00000027953
AA Change: I38N

DomainStartEndE-ValueType
Pfam:MtN3_slv 1 63 1.7e-23 PFAM
transmembrane domain 64 86 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137975
Predicted Effect probably benign
Transcript: ENSMUST00000185119
SMART Domains Protein: ENSMUSP00000139128
Gene: ENSMUSG00000027953

DomainStartEndE-ValueType
Pfam:MtN3_slv 9 74 1.6e-14 PFAM
Meta Mutation Damage Score 0.7076 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Slc50a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03406:Slc50a1 APN 3 89270101 missense possibly damaging 0.92
R3964:Slc50a1 UTSW 3 89268786 missense probably benign 0.00
R5877:Slc50a1 UTSW 3 89269153 missense probably damaging 1.00
R6716:Slc50a1 UTSW 3 89269907 missense probably damaging 0.96
R8286:Slc50a1 UTSW 3 89270403 splice site probably null
R8287:Slc50a1 UTSW 3 89270403 splice site probably null
R8534:Slc50a1 UTSW 3 89270403 splice site probably null
Y4338:Slc50a1 UTSW 3 89270110 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AAAGGGTTGACTTCATGGGCAG -3'
(R):5'- CACCACGGATGTCAAGTGAG -3'

Sequencing Primer
(F):5'- CCTTCTAGGAAAGGGAATTAATGCC -3'
(R):5'- CACGGATGTCAAGTGAGAGTGTTG -3'
Posted On2015-04-06