Incidental Mutation 'R3843:Pdp1'
ID277237
Institutional Source Beutler Lab
Gene Symbol Pdp1
Ensembl Gene ENSMUSG00000049225
Gene Namepyruvate dehyrogenase phosphatase catalytic subunit 1
SynonymsLOC381511, Ppm2c
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location11958184-11966452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11961961 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 117 (K117E)
Ref Sequence ENSEMBL: ENSMUSP00000103937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056050] [ENSMUST00000095144] [ENSMUST00000108297] [ENSMUST00000108299] [ENSMUST00000108301] [ENSMUST00000108302]
Predicted Effect probably benign
Transcript: ENSMUST00000056050
AA Change: K77E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050521
Gene: ENSMUSG00000049225
AA Change: K77E

DomainStartEndE-ValueType
PP2Cc 99 523 3.36e-97 SMART
PP2C_SIG 177 525 2.77e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095144
AA Change: K102E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092766
Gene: ENSMUSG00000049225
AA Change: K102E

DomainStartEndE-ValueType
PP2Cc 124 548 3.36e-97 SMART
PP2C_SIG 202 550 2.77e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108297
AA Change: K77E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103932
Gene: ENSMUSG00000049225
AA Change: K77E

DomainStartEndE-ValueType
PP2Cc 99 523 3.36e-97 SMART
PP2C_SIG 177 525 2.77e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108299
AA Change: K102E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103934
Gene: ENSMUSG00000049225
AA Change: K102E

DomainStartEndE-ValueType
PP2Cc 124 548 3.36e-97 SMART
PP2C_SIG 202 550 2.77e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108301
AA Change: K136E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103936
Gene: ENSMUSG00000049225
AA Change: K136E

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
PP2Cc 158 582 3.36e-97 SMART
PP2C_SIG 236 584 2.77e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108302
AA Change: K117E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103937
Gene: ENSMUSG00000049225
AA Change: K117E

DomainStartEndE-ValueType
PP2Cc 139 563 3.36e-97 SMART
PP2C_SIG 217 565 2.77e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154194
Meta Mutation Damage Score 0.0683 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pyruvate dehydrogenase (E1) is one of the three components (E1, E2, and E3) of the large pyruvate dehydrogenase complex. Pyruvate dehydrogenase kinases catalyze phosphorylation of serine residues of E1 to inactivate the E1 component and inhibit the complex. Pyruvate dehydrogenase phosphatases catalyze the dephosphorylation and activation of the E1 component to reverse the effects of pyruvate dehydrogenase kinases. Pyruvate dehydrogenase phosphatase is a heterodimer consisting of catalytic and regulatory subunits. Two catalytic subunits have been reported; one is predominantly expressed in skeletal muscle and another one is is much more abundant in the liver. The catalytic subunit, encoded by this gene, is the former, and belongs to the protein phosphatase 2C (PP2C) superfamily. Along with the pyruvate dehydrogenase complex and pyruvate dehydrogenase kinases, this enzyme is located in the mitochondrial matrix. Mutation in this gene causes pyruvate dehydrogenase phosphatase deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Pdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02243:Pdp1 APN 4 11961873 missense probably benign 0.20
IGL02643:Pdp1 APN 4 11962062 missense probably benign
R1931:Pdp1 UTSW 4 11962074 missense probably benign 0.01
R2162:Pdp1 UTSW 4 11961123 missense probably damaging 0.98
R2418:Pdp1 UTSW 4 11961838 missense probably damaging 0.98
R5699:Pdp1 UTSW 4 11960907 missense possibly damaging 0.79
R6479:Pdp1 UTSW 4 11961327 missense probably damaging 1.00
R7221:Pdp1 UTSW 4 11961004 missense probably damaging 0.99
R7263:Pdp1 UTSW 4 11960821 missense possibly damaging 0.82
R8483:Pdp1 UTSW 4 11961982 missense probably benign
Z1177:Pdp1 UTSW 4 11961639 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CTTTCACTGACTGCCTGGGAAC -3'
(R):5'- TGGCACTGCATGTTACTGCC -3'

Sequencing Primer
(F):5'- AGCATCCCTCTGGTCTGCAAG -3'
(R):5'- ACTGCATGTTACTGCCACCAC -3'
Posted On2015-04-06