Incidental Mutation 'R3843:Aass'
ID277243
Institutional Source Beutler Lab
Gene Symbol Aass
Ensembl Gene ENSMUSG00000029695
Gene Nameaminoadipate-semialdehyde synthase
SynonymsLOR/SDH, Lorsdh
MMRRC Submission 040783-MU
Accession Numbers

NCBI RefSeq: NM_013930.4; MGI:1353573

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location23072173-23132986 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 23092496 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 168 (Y168*)
Ref Sequence ENSEMBL: ENSMUSP00000115079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031707] [ENSMUST00000149864]
Predicted Effect probably null
Transcript: ENSMUST00000031707
AA Change: Y578*
SMART Domains Protein: ENSMUSP00000031707
Gene: ENSMUSG00000029695
AA Change: Y578*

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
AlaDh_PNT_N 27 157 2.76e-22 SMART
AlaDh_PNT_C 197 399 7.94e-23 SMART
Pfam:Sacchrp_dh_NADP 483 598 2.8e-26 PFAM
Pfam:Sacchrp_dh_C 602 916 1.2e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138063
Predicted Effect probably null
Transcript: ENSMUST00000149864
AA Change: Y168*
SMART Domains Protein: ENSMUSP00000115079
Gene: ENSMUSG00000029695
AA Change: Y168*

DomainStartEndE-ValueType
Pfam:Saccharop_dh 73 209 8.2e-45 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: This gene encodes a bifunctional mitochondrial protein that catalyzes the first two steps in the lysine degradation pathway. The N-terminus contains lysine-ketoglutarate reductase activity and converts lysine to saccharopine, whereas the C-terminus contains saccharopine dehydrogenase activity and converts saccharopine to alpha-aminoadipate semialdehyde. Mutations in a human gene encoding a highly similar protein are associated with familial hyperlysinemia. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(10) : Targeted(2) Gene trapped(8

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Aass
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Aass APN 6 23075852 missense probably benign 0.10
IGL01465:Aass APN 6 23114839 critical splice donor site probably null
IGL01617:Aass APN 6 23115150 missense possibly damaging 0.89
IGL01810:Aass APN 6 23107634 missense probably damaging 0.99
IGL02024:Aass APN 6 23113706 missense probably damaging 1.00
IGL02167:Aass APN 6 23122722 intron probably benign
IGL02339:Aass APN 6 23093966 missense probably damaging 0.99
IGL02720:Aass APN 6 23122703 intron probably benign
IGL02877:Aass APN 6 23078876 nonsense probably null
IGL02948:Aass APN 6 23094319 splice site probably benign
PIT4651001:Aass UTSW 6 23118751 missense probably benign 0.00
R0152:Aass UTSW 6 23074689 missense probably damaging 1.00
R0196:Aass UTSW 6 23109520 missense probably damaging 1.00
R0546:Aass UTSW 6 23077077 critical splice donor site probably null
R0841:Aass UTSW 6 23075811 missense probably benign
R0848:Aass UTSW 6 23114985 missense probably damaging 0.98
R0942:Aass UTSW 6 23075152 splice site probably benign
R1082:Aass UTSW 6 23093908 missense probably damaging 1.00
R1159:Aass UTSW 6 23115138 missense probably damaging 0.99
R1730:Aass UTSW 6 23121019 missense probably damaging 1.00
R1818:Aass UTSW 6 23075858 critical splice acceptor site probably null
R1906:Aass UTSW 6 23072985 missense probably benign 0.00
R2004:Aass UTSW 6 23092562 nonsense probably null
R2191:Aass UTSW 6 23078866 missense possibly damaging 0.91
R3690:Aass UTSW 6 23091329 missense probably benign 0.09
R3879:Aass UTSW 6 23122521 missense probably damaging 1.00
R4080:Aass UTSW 6 23109498 missense possibly damaging 0.83
R4081:Aass UTSW 6 23109498 missense possibly damaging 0.83
R4082:Aass UTSW 6 23109498 missense possibly damaging 0.83
R4348:Aass UTSW 6 23113739 missense probably benign 0.03
R4622:Aass UTSW 6 23092330 missense probably damaging 1.00
R4701:Aass UTSW 6 23075856 nonsense probably null
R4823:Aass UTSW 6 23107691 missense probably benign
R5108:Aass UTSW 6 23094208 missense probably damaging 0.99
R5248:Aass UTSW 6 23109438 missense probably benign 0.08
R5481:Aass UTSW 6 23113476 missense probably benign 0.00
R5776:Aass UTSW 6 23107650 missense possibly damaging 0.66
R5883:Aass UTSW 6 23072994 missense probably benign 0.04
R6356:Aass UTSW 6 23093902 missense probably damaging 1.00
R6594:Aass UTSW 6 23113433 missense probably benign 0.00
R6784:Aass UTSW 6 23093896 missense probably null 1.00
R6855:Aass UTSW 6 23114845 missense probably damaging 0.97
R7184:Aass UTSW 6 23094220 missense possibly damaging 0.55
R7208:Aass UTSW 6 23074630 missense probably damaging 0.99
R7464:Aass UTSW 6 23077153 missense possibly damaging 0.69
R7750:Aass UTSW 6 23075200 missense possibly damaging 0.58
R7821:Aass UTSW 6 23120930 missense probably damaging 1.00
R8262:Aass UTSW 6 23107710 missense possibly damaging 0.94
R8303:Aass UTSW 6 23092368 missense probably benign 0.03
R8430:Aass UTSW 6 23078982 missense probably benign 0.01
R8817:Aass UTSW 6 23097196 nonsense probably null
Z1176:Aass UTSW 6 23078857 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGTGATCAAGACCAGGG -3'
(R):5'- AGTCCTTGGTCATTTCTGAGAG -3'

Sequencing Primer
(F):5'- GGGTCTAATCCCAACTCACCAATG -3'
(R):5'- CCTTGGTCATTTCTGAGAGAATTC -3'
Posted On2015-04-06