Incidental Mutation 'R3843:Ccdc8'
ID277245
Institutional Source Beutler Lab
Gene Symbol Ccdc8
Ensembl Gene ENSMUSG00000041117
Gene Namecoiled-coil domain containing 8
SynonymsENSMUSG00000041117
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16992708-16997516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16995114 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 176 (V176A)
Ref Sequence ENSEMBL: ENSMUSP00000092399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094805]
Predicted Effect probably damaging
Transcript: ENSMUST00000094805
AA Change: V176A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092399
Gene: ENSMUSG00000041117
AA Change: V176A

DomainStartEndE-ValueType
Pfam:PNMA 1 98 1.3e-19 PFAM
low complexity region 166 171 N/A INTRINSIC
internal_repeat_1 207 275 5.53e-5 PROSPERO
low complexity region 297 332 N/A INTRINSIC
low complexity region 335 420 N/A INTRINSIC
low complexity region 430 452 N/A INTRINSIC
low complexity region 458 468 N/A INTRINSIC
low complexity region 478 540 N/A INTRINSIC
internal_repeat_1 566 640 5.53e-5 PROSPERO
low complexity region 646 658 N/A INTRINSIC
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein functions as a cofactor required for p53-mediated apoptosis following DNA damage, and may also play a role in growth through interactions with the cytoskeletal adaptor protein obscurin-like 1. Mutations in this gene are a cause of 3M syndrome-3 (3M3). [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Ccdc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Ccdc8 APN 7 16996042 missense unknown
R0255:Ccdc8 UTSW 7 16995657 missense unknown
R0504:Ccdc8 UTSW 7 16996014 missense unknown
R5054:Ccdc8 UTSW 7 16995045 missense probably damaging 1.00
R6020:Ccdc8 UTSW 7 16996581 missense probably damaging 0.99
R6045:Ccdc8 UTSW 7 16996031 missense unknown
R6244:Ccdc8 UTSW 7 16996251 missense probably benign 0.04
R6753:Ccdc8 UTSW 7 16996637 nonsense probably null
R7299:Ccdc8 UTSW 7 16996031 missense unknown
R7567:Ccdc8 UTSW 7 16994762 missense probably damaging 1.00
R7623:Ccdc8 UTSW 7 16996612 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GTCAAAGGCAACAGGAGCTC -3'
(R):5'- TGGAGCTATCATCGTCCGAG -3'

Sequencing Primer
(F):5'- ACTTGGGCAGCAAATTCC -3'
(R):5'- ATCATCGTCCGAGCTGGCTTG -3'
Posted On2015-04-06