Incidental Mutation 'R3843:Ppfia1'
ID277248
Institutional Source Beutler Lab
Gene Symbol Ppfia1
Ensembl Gene ENSMUSG00000037519
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
SynonymsLiprin-alpha1, liprin, C030014K08Rik
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location144476758-144553729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 144504970 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 698 (R698Q)
Ref Sequence ENSEMBL: ENSMUSP00000126233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168134] [ENSMUST00000182226]
Predicted Effect probably benign
Transcript: ENSMUST00000168134
AA Change: R698Q

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126233
Gene: ENSMUSG00000037519
AA Change: R698Q

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
coiled coil region 36 137 N/A INTRINSIC
coiled coil region 250 517 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
coiled coil region 621 667 N/A INTRINSIC
low complexity region 681 703 N/A INTRINSIC
low complexity region 750 760 N/A INTRINSIC
low complexity region 791 799 N/A INTRINSIC
SAM 884 953 5.22e-7 SMART
low complexity region 954 966 N/A INTRINSIC
SAM 999 1066 3.89e-6 SMART
SAM 1087 1159 1.14e-7 SMART
low complexity region 1207 1218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182226
AA Change: R723Q

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138312
Gene: ENSMUSG00000037519
AA Change: R723Q

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
coiled coil region 36 137 N/A INTRINSIC
coiled coil region 250 389 N/A INTRINSIC
coiled coil region 411 542 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
coiled coil region 646 692 N/A INTRINSIC
low complexity region 706 728 N/A INTRINSIC
low complexity region 775 785 N/A INTRINSIC
low complexity region 816 824 N/A INTRINSIC
SAM 909 978 5.22e-7 SMART
low complexity region 979 991 N/A INTRINSIC
SAM 1024 1091 3.89e-6 SMART
SAM 1112 1184 1.14e-7 SMART
low complexity region 1232 1243 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182958
AA Change: R232Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183197
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. This protein binds to the intracellular membrane-distal phosphatase domain of tyrosine phosphatase LAR, and appears to localize LAR to cell focal adhesions. This interaction may regulate the disassembly of focal adhesion and thus help orchestrate cell-matrix interactions. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Ppfia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Ppfia1 APN 7 144481719 missense probably benign 0.00
IGL01771:Ppfia1 APN 7 144482357 missense probably benign 0.36
IGL02220:Ppfia1 APN 7 144481775 missense probably damaging 1.00
IGL02683:Ppfia1 APN 7 144513358 missense probably damaging 0.99
IGL02752:Ppfia1 APN 7 144519604 missense probably benign
PIT1430001:Ppfia1 UTSW 7 144498336 missense probably damaging 1.00
R0081:Ppfia1 UTSW 7 144504974 missense probably damaging 1.00
R0304:Ppfia1 UTSW 7 144482345 missense probably damaging 1.00
R0359:Ppfia1 UTSW 7 144485192 missense probably damaging 0.97
R1836:Ppfia1 UTSW 7 144519631 missense probably benign 0.19
R1934:Ppfia1 UTSW 7 144505110 missense probably benign 0.12
R2195:Ppfia1 UTSW 7 144516107 missense probably damaging 1.00
R3759:Ppfia1 UTSW 7 144516002 missense probably benign 0.34
R4606:Ppfia1 UTSW 7 144485192 missense probably damaging 0.97
R4820:Ppfia1 UTSW 7 144498369 missense probably benign 0.33
R4898:Ppfia1 UTSW 7 144491576 missense probably damaging 1.00
R5069:Ppfia1 UTSW 7 144514473 nonsense probably null
R5070:Ppfia1 UTSW 7 144514473 nonsense probably null
R5076:Ppfia1 UTSW 7 144506264 missense probably damaging 1.00
R5280:Ppfia1 UTSW 7 144485095 missense possibly damaging 0.84
R5473:Ppfia1 UTSW 7 144491492 missense probably benign 0.17
R5656:Ppfia1 UTSW 7 144519974 critical splice donor site probably null
R5818:Ppfia1 UTSW 7 144520568 intron probably benign
R6104:Ppfia1 UTSW 7 144491574 missense possibly damaging 0.95
R6299:Ppfia1 UTSW 7 144510312 missense probably benign 0.11
R6474:Ppfia1 UTSW 7 144506205 missense possibly damaging 0.89
R6705:Ppfia1 UTSW 7 144519174 missense possibly damaging 0.93
R6734:Ppfia1 UTSW 7 144479053 missense probably damaging 1.00
R7062:Ppfia1 UTSW 7 144552473 missense probably benign
R7451:Ppfia1 UTSW 7 144508210 missense probably benign
R7514:Ppfia1 UTSW 7 144517713 missense probably benign 0.01
R7552:Ppfia1 UTSW 7 144506245 missense probably damaging 1.00
R7633:Ppfia1 UTSW 7 144552436 missense possibly damaging 0.89
R7886:Ppfia1 UTSW 7 144519283 missense probably benign
R7969:Ppfia1 UTSW 7 144519283 missense probably benign
R8038:Ppfia1 UTSW 7 144514916 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ACTAAGTGGTAATGTGCTGGTC -3'
(R):5'- ACACACAGAGCTTCCTGGTG -3'

Sequencing Primer
(F):5'- ACAGGTTCTCATGATATACCCCGG -3'
(R):5'- CTTCCTGGTGAAGTATGGCC -3'
Posted On2015-04-06