Incidental Mutation 'R3843:Ckap2'
ID277250
Institutional Source Beutler Lab
Gene Symbol Ckap2
Ensembl Gene ENSMUSG00000037725
Gene Namecytoskeleton associated protein 2
SynonymsLB1
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22168160-22185819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22175758 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 424 (N424K)
Ref Sequence ENSEMBL: ENSMUSP00000039518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046916]
Predicted Effect probably damaging
Transcript: ENSMUST00000046916
AA Change: N424K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039518
Gene: ENSMUSG00000037725
AA Change: N424K

DomainStartEndE-ValueType
low complexity region 221 234 N/A INTRINSIC
Pfam:CKAP2_C 315 651 3.9e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211045
Meta Mutation Damage Score 0.1554 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeleton-associated protein that stabalizes microtubules and plays a role in the regulation of cell division. The encoded protein is itself regulated through phosphorylation at multiple serine and threonine residues. There is a pseudogene of this gene on chromosome 14. Alternative splicing results in multiple transcript variations. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Ckap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Ckap2 APN 8 22169758 missense probably damaging 1.00
IGL01519:Ckap2 APN 8 22168898 missense probably benign 0.00
R0530:Ckap2 UTSW 8 22175972 splice site probably benign
R1638:Ckap2 UTSW 8 22175796 missense possibly damaging 0.84
R1965:Ckap2 UTSW 8 22175787 missense possibly damaging 0.95
R2047:Ckap2 UTSW 8 22168747 missense probably benign 0.03
R3023:Ckap2 UTSW 8 22175861 missense possibly damaging 0.95
R4587:Ckap2 UTSW 8 22176976 missense probably benign
R4754:Ckap2 UTSW 8 22168895 missense possibly damaging 0.93
R4847:Ckap2 UTSW 8 22175068 missense probably damaging 0.98
R5354:Ckap2 UTSW 8 22177565 missense probably damaging 0.96
R5423:Ckap2 UTSW 8 22177196 missense probably benign 0.33
R5717:Ckap2 UTSW 8 22175047 missense probably damaging 0.98
R6518:Ckap2 UTSW 8 22173303 missense probably benign 0.41
R7088:Ckap2 UTSW 8 22169866 missense possibly damaging 0.59
R7466:Ckap2 UTSW 8 22177386 missense probably benign 0.02
X0058:Ckap2 UTSW 8 22176798 missense probably benign
Z1176:Ckap2 UTSW 8 22169794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGAGCATGTGTGGCAC -3'
(R):5'- GAAAGGGGCTAAAACGACCTCC -3'

Sequencing Primer
(F):5'- CAGAGGATCTGGGTTCAATTCCC -3'
(R):5'- CTCATTCAGTAGTCACCCAGG -3'
Posted On2015-04-06