Incidental Mutation 'R3843:Amt'
ID277251
Institutional Source Beutler Lab
Gene Symbol Amt
Ensembl Gene ENSMUSG00000032607
Gene Nameaminomethyltransferase
SynonymsEG434437
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108296853-108302302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108297221 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 62 (R62C)
Ref Sequence ENSEMBL: ENSMUSP00000035230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035227] [ENSMUST00000035230]
Predicted Effect probably benign
Transcript: ENSMUST00000035227
Predicted Effect possibly damaging
Transcript: ENSMUST00000035230
AA Change: R62C

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035230
Gene: ENSMUSG00000032607
AA Change: R62C

DomainStartEndE-ValueType
Pfam:GCV_T 38 291 7.8e-86 PFAM
Pfam:GCV_T_C 300 392 1.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195695
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of four critical components of the glycine cleavage system. Mutations in this gene have been associated with glycine encephalopathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele develop neural tubes defects at high frequency and exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Amt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02657:Amt APN 9 108301380 missense probably damaging 1.00
IGL03277:Amt APN 9 108301219 missense probably benign
R1333:Amt UTSW 9 108301097 missense probably benign 0.04
R1856:Amt UTSW 9 108297162 missense probably damaging 1.00
R3844:Amt UTSW 9 108297221 missense possibly damaging 0.74
R3903:Amt UTSW 9 108297221 missense possibly damaging 0.74
R3904:Amt UTSW 9 108297221 missense possibly damaging 0.74
R4729:Amt UTSW 9 108300652 missense probably damaging 1.00
R4814:Amt UTSW 9 108299780 missense probably benign
R5149:Amt UTSW 9 108301451 missense possibly damaging 0.59
R6000:Amt UTSW 9 108301485 missense probably benign 0.20
R6044:Amt UTSW 9 108297251 missense probably damaging 1.00
R6911:Amt UTSW 9 108301229 critical splice donor site probably null
R6957:Amt UTSW 9 108299833 missense possibly damaging 0.51
R7618:Amt UTSW 9 108299878 missense probably damaging 1.00
R7658:Amt UTSW 9 108297231 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACTCAGTTCTGTACAGGTGGG -3'
(R):5'- ATCTCCTGAGTTAGCCCTCTAG -3'

Sequencing Primer
(F):5'- CTCAGTTCTGTACAGGTGGGATAAAG -3'
(R):5'- GAGTTAGCCCTCTAGAGTCCCTAAC -3'
Posted On2015-04-06