Incidental Mutation 'R3843:Zfp651'
ID277253
Institutional Source Beutler Lab
Gene Symbol Zfp651
Ensembl Gene ENSMUSG00000013419
Gene Namezinc finger protein 651
Synonyms4732420M22Rik
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R3843 (G1)
Quality Score207
Status Validated
Chromosome9
Chromosomal Location121759330-121771742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121763433 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 273 (V273E)
Ref Sequence ENSEMBL: ENSMUSP00000091286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093772]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093772
AA Change: V273E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091286
Gene: ENSMUSG00000013419
AA Change: V273E

DomainStartEndE-ValueType
BTB 45 141 3.69e-19 SMART
low complexity region 159 164 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
low complexity region 217 231 N/A INTRINSIC
low complexity region 302 339 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
ZnF_C2H2 447 470 1.28e-3 SMART
ZnF_C2H2 474 494 8.4e1 SMART
ZnF_C2H2 501 524 1.76e-1 SMART
ZnF_C2H2 531 553 3.34e-2 SMART
ZnF_C2H2 559 581 6.78e-3 SMART
ZnF_C2H2 587 609 3.63e-3 SMART
ZnF_C2H2 615 637 1.95e-3 SMART
ZnF_C2H2 643 665 6.62e-6 SMART
ZnF_C2H2 671 698 4.16e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213743
Predicted Effect unknown
Transcript: ENSMUST00000214732
AA Change: V308E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216791
Meta Mutation Damage Score 0.0770 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Other mutations in Zfp651
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01913:Zfp651 APN 9 121763969 missense probably damaging 1.00
R0193:Zfp651 UTSW 9 121767666 missense probably damaging 0.98
R0270:Zfp651 UTSW 9 121767575 missense probably benign 0.27
R0347:Zfp651 UTSW 9 121763102 missense probably damaging 1.00
R0654:Zfp651 UTSW 9 121763261 missense probably benign 0.01
R2202:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2203:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2204:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2205:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2364:Zfp651 UTSW 9 121767594 missense probably damaging 0.98
R4275:Zfp651 UTSW 9 121766539 missense probably damaging 1.00
R4934:Zfp651 UTSW 9 121763979 missense probably damaging 0.99
R5358:Zfp651 UTSW 9 121765595 missense probably damaging 1.00
R5462:Zfp651 UTSW 9 121767663 missense probably damaging 0.99
R5613:Zfp651 UTSW 9 121767519 missense probably damaging 1.00
R5843:Zfp651 UTSW 9 121767339 missense possibly damaging 0.47
R5863:Zfp651 UTSW 9 121767530 missense probably benign 0.22
R6009:Zfp651 UTSW 9 121762871 missense possibly damaging 0.86
R6063:Zfp651 UTSW 9 121763532 missense probably benign 0.01
R6114:Zfp651 UTSW 9 121765595 missense probably damaging 1.00
R6223:Zfp651 UTSW 9 121763787 missense possibly damaging 0.61
R6414:Zfp651 UTSW 9 121763659 missense probably benign
R6811:Zfp651 UTSW 9 121766529 missense probably damaging 1.00
R7394:Zfp651 UTSW 9 121767345 missense probably damaging 0.98
R7430:Zfp651 UTSW 9 121763666 missense probably benign 0.02
R8215:Zfp651 UTSW 9 121767278 missense probably benign 0.40
R8900:Zfp651 UTSW 9 121767639 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGACACTCTTCAAGGAGGAG -3'
(R):5'- CGTGTGGACATTCGGCTATG -3'

Sequencing Primer
(F):5'- CACTCTTCAAGGAGGAGAAGGAAG -3'
(R):5'- ATCCTCTCGATGATCGCTGGG -3'
Posted On2015-04-06