Incidental Mutation 'R3843:Cdhr1'
ID277257
Institutional Source Beutler Lab
Gene Symbol Cdhr1
Ensembl Gene ENSMUSG00000021803
Gene Namecadherin-related family member 1
SynonymsPcdh21, Prcad
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location37077857-37098347 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 37084927 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 440 (F440L)
Ref Sequence ENSEMBL: ENSMUSP00000022337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022337]
Predicted Effect probably benign
Transcript: ENSMUST00000022337
AA Change: F440L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000022337
Gene: ENSMUSG00000021803
AA Change: F440L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 57 133 9.4e-7 SMART
CA 157 245 9.44e-21 SMART
CA 269 352 2.06e-12 SMART
CA 383 471 2.68e-11 SMART
CA 495 575 5.26e-19 SMART
CA 594 685 1.64e-6 SMART
transmembrane domain 703 725 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
low complexity region 789 799 N/A INTRINSIC
low complexity region 817 829 N/A INTRINSIC
Meta Mutation Damage Score 0.2556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the cadherin superfamily of calcium-dependent cell adhesion molecules. The encoded protein is a photoreceptor-specific cadherin that plays a role in outer segment disc morphogenesis. Mutations in this gene are associated with inherited retinal dystrophies. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit progressive degeneration of retinal photoreceptor cells and a slight reduction in light responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Cdhr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Cdhr1 APN 14 37085528 missense probably benign 0.06
IGL01820:Cdhr1 APN 14 37085579 missense probably benign 0.11
IGL02469:Cdhr1 APN 14 37085600 missense possibly damaging 0.68
IGL03373:Cdhr1 APN 14 37096300 missense possibly damaging 0.89
IGL03055:Cdhr1 UTSW 14 37095097 missense probably benign 0.07
PIT4494001:Cdhr1 UTSW 14 37082856 missense probably benign 0.07
R0110:Cdhr1 UTSW 14 37080676 missense probably damaging 0.99
R0219:Cdhr1 UTSW 14 37079601 missense possibly damaging 0.82
R0265:Cdhr1 UTSW 14 37081376 missense probably benign 0.02
R0450:Cdhr1 UTSW 14 37080676 missense probably damaging 0.99
R0510:Cdhr1 UTSW 14 37080676 missense probably damaging 0.99
R0522:Cdhr1 UTSW 14 37094000 critical splice donor site probably null
R0788:Cdhr1 UTSW 14 37087375 critical splice donor site probably null
R0880:Cdhr1 UTSW 14 37080634 missense possibly damaging 0.53
R1209:Cdhr1 UTSW 14 37082942 splice site probably null
R1253:Cdhr1 UTSW 14 37079625 missense probably benign
R1604:Cdhr1 UTSW 14 37095093 missense probably benign 0.29
R1968:Cdhr1 UTSW 14 37079725 missense probably benign 0.00
R2064:Cdhr1 UTSW 14 37095105 missense probably benign 0.10
R2248:Cdhr1 UTSW 14 37081377 missense probably benign
R4178:Cdhr1 UTSW 14 37082939 splice site probably null
R4205:Cdhr1 UTSW 14 37080504 missense probably benign 0.00
R4681:Cdhr1 UTSW 14 37096237 missense probably benign 0.01
R5039:Cdhr1 UTSW 14 37079643 missense probably benign 0.02
R5088:Cdhr1 UTSW 14 37089465 missense probably benign 0.08
R5383:Cdhr1 UTSW 14 37089007 missense possibly damaging 0.94
R5507:Cdhr1 UTSW 14 37082845 missense probably damaging 0.98
R5933:Cdhr1 UTSW 14 37089462 missense probably benign 0.01
R6074:Cdhr1 UTSW 14 37079643 missense probably benign 0.02
R6291:Cdhr1 UTSW 14 37089465 missense probably benign 0.31
R6449:Cdhr1 UTSW 14 37090597 missense probably benign 0.35
R6890:Cdhr1 UTSW 14 37085645 missense probably damaging 1.00
R6891:Cdhr1 UTSW 14 37097377 splice site probably null
R7653:Cdhr1 UTSW 14 37082201 missense probably benign 0.27
R7740:Cdhr1 UTSW 14 37089380 missense probably damaging 0.98
R7805:Cdhr1 UTSW 14 37081545 missense probably benign 0.00
R8081:Cdhr1 UTSW 14 37094010 missense probably benign 0.01
R8147:Cdhr1 UTSW 14 37079652 missense probably benign 0.02
R8164:Cdhr1 UTSW 14 37079542 missense probably damaging 1.00
R8283:Cdhr1 UTSW 14 37082780 missense probably benign 0.00
R8343:Cdhr1 UTSW 14 37091978 missense probably benign 0.00
R8848:Cdhr1 UTSW 14 37080574 missense probably benign 0.21
X0062:Cdhr1 UTSW 14 37079779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTTCACATGCCCATTGGATG -3'
(R):5'- GGCGTGTAAGGGTTCTACATC -3'

Sequencing Primer
(F):5'- CCATTGGATGGGCAGAGACTCTG -3'
(R):5'- GTGTAAGGGTTCTACATCTAGCCC -3'
Posted On2015-04-06