Incidental Mutation 'R3843:Pnp2'
ID277258
Institutional Source Beutler Lab
Gene Symbol Pnp2
Ensembl Gene ENSMUSG00000068417
Gene Namepurine-nucleoside phosphorylase 2
Synonyms
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50955992-50964749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50963421 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 121 (L121Q)
Ref Sequence ENSEMBL: ENSMUSP00000093615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095925] [ENSMUST00000178092] [ENSMUST00000227052]
Predicted Effect probably null
Transcript: ENSMUST00000095925
AA Change: L121Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093615
Gene: ENSMUSG00000068417
AA Change: L121Q

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 41 295 4.9e-56 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178092
SMART Domains Protein: ENSMUSP00000136557
Gene: ENSMUSG00000115338

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 26 280 2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228593
Meta Mutation Damage Score 0.8846 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Pnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Pnp2 APN 14 50959553 missense probably damaging 1.00
IGL02418:Pnp2 APN 14 50963836 missense possibly damaging 0.51
IGL03216:Pnp2 APN 14 50963197 missense probably benign 0.01
IGL03388:Pnp2 APN 14 50963538 missense probably damaging 1.00
R0049:Pnp2 UTSW 14 50959533 nonsense probably null
R0097:Pnp2 UTSW 14 50963501 missense probably benign 0.08
R0123:Pnp2 UTSW 14 50963177 missense probably damaging 1.00
R0134:Pnp2 UTSW 14 50963177 missense probably damaging 1.00
R0158:Pnp2 UTSW 14 50964304 missense probably damaging 1.00
R1477:Pnp2 UTSW 14 50959535 missense probably benign 0.35
R1820:Pnp2 UTSW 14 50964457 missense possibly damaging 0.93
R1934:Pnp2 UTSW 14 50956218 missense probably benign
R2138:Pnp2 UTSW 14 50963704 missense probably damaging 1.00
R4355:Pnp2 UTSW 14 50959625 missense probably benign
R4938:Pnp2 UTSW 14 50963568 splice site probably null
R5516:Pnp2 UTSW 14 50963738 missense probably benign 0.33
R5636:Pnp2 UTSW 14 50956192 splice site probably null
R6396:Pnp2 UTSW 14 50963159 missense probably damaging 1.00
R7117:Pnp2 UTSW 14 50964474 makesense probably null
R7862:Pnp2 UTSW 14 50963559 missense possibly damaging 0.95
R7934:Pnp2 UTSW 14 50964446 missense probably benign 0.00
R8057:Pnp2 UTSW 14 50964381 missense probably benign 0.06
R8104:Pnp2 UTSW 14 50959642 missense probably benign 0.00
R8488:Pnp2 UTSW 14 50964379 missense possibly damaging 0.79
R8519:Pnp2 UTSW 14 50964385 missense probably damaging 1.00
R8791:Pnp2 UTSW 14 50963416 missense probably benign 0.00
R8916:Pnp2 UTSW 14 50963777 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCAGGGGCACAAGCTTG -3'
(R):5'- GACAAGGCCAGACTCTCTAC -3'

Sequencing Primer
(F):5'- GCACAAGCTTGGTTGGATC -3'
(R):5'- AGGCCAGACTCTCTACATGTAG -3'
Posted On2015-04-06