Incidental Mutation 'R3843:Elp3'
ID 277259
Institutional Source Beutler Lab
Gene Symbol Elp3
Ensembl Gene ENSMUSG00000022031
Gene Name elongator acetyltransferase complex subunit 3
Synonyms KAT9, 2610507P14Rik
MMRRC Submission 040783-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.957) question?
Stock # R3843 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 65767898-65830524 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 65802932 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022609] [ENSMUST00000022609] [ENSMUST00000224743] [ENSMUST00000225355] [ENSMUST00000225355]
AlphaFold Q9CZX0
Predicted Effect probably null
Transcript: ENSMUST00000022609
SMART Domains Protein: ENSMUSP00000022609
Gene: ENSMUSG00000022031

DomainStartEndE-ValueType
Elp3 108 370 1.36e-37 SMART
Blast:Elp3 387 431 2e-19 BLAST
Pfam:Acetyltransf_1 460 555 1.1e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000022609
SMART Domains Protein: ENSMUSP00000022609
Gene: ENSMUSG00000022031

DomainStartEndE-ValueType
Elp3 108 370 1.36e-37 SMART
Blast:Elp3 387 431 2e-19 BLAST
Pfam:Acetyltransf_1 460 555 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224743
Predicted Effect probably null
Transcript: ENSMUST00000225355
Predicted Effect probably null
Transcript: ENSMUST00000225355
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ELP3 is the catalytic subunit of the histone acetyltransferase elongator complex, which contributes to transcript elongation and also regulates the maturation of projection neurons (Creppe et al., 2009 [PubMed 19185337]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Embryos homozygous for a null gene trap mutation show severe growth retardation and die prior to E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,495 (GRCm39) Y168* probably null Het
Amt C T 9: 108,174,420 (GRCm39) R62C possibly damaging Het
Arid2 C T 15: 96,249,721 (GRCm39) T145I possibly damaging Het
Ccdc8 T C 7: 16,729,039 (GRCm39) V176A probably damaging Het
Cdhr1 G T 14: 36,806,884 (GRCm39) F440L probably benign Het
Ckap2 A T 8: 22,665,774 (GRCm39) N424K probably damaging Het
Col6a1 C T 10: 76,547,175 (GRCm39) R730H unknown Het
Dennd1b C A 1: 138,981,092 (GRCm39) P102Q probably damaging Het
E2f1 A G 2: 154,402,748 (GRCm39) S340P probably benign Het
Eef1akmt2 C T 7: 132,433,305 (GRCm39) V134I probably damaging Het
Grap T G 11: 61,551,151 (GRCm39) probably null Het
Heatr1 T C 13: 12,450,002 (GRCm39) Y1999H probably benign Het
Hectd4 G T 5: 121,397,936 (GRCm39) W288L possibly damaging Het
Hnf4g G A 3: 3,716,362 (GRCm39) C262Y probably benign Het
Hrh4 A G 18: 13,155,343 (GRCm39) Y294C possibly damaging Het
Igkv5-39 C A 6: 69,877,526 (GRCm39) G77W probably damaging Het
Kdm2b A T 5: 123,072,856 (GRCm39) Y341N probably damaging Het
Kif26b T C 1: 178,755,742 (GRCm39) L1952P probably damaging Het
Lgr4 C T 2: 109,827,118 (GRCm39) probably benign Het
Nlrc3 G A 16: 3,782,828 (GRCm39) R194W probably benign Het
Nup214 T C 2: 31,941,112 (GRCm39) F547L probably damaging Het
Or5m3 A G 2: 85,838,548 (GRCm39) I143V probably benign Het
Pdp1 T C 4: 11,961,961 (GRCm39) K117E probably benign Het
Phtf2 G A 5: 20,979,020 (GRCm39) A31V probably damaging Het
Pip4p2 T A 4: 14,886,553 (GRCm39) Y42* probably null Het
Pkhd1 A T 1: 20,628,947 (GRCm39) C667S probably benign Het
Pnp2 T A 14: 51,200,878 (GRCm39) L121Q probably null Het
Ppfia1 C T 7: 144,058,707 (GRCm39) R698Q probably benign Het
Sidt1 A T 16: 44,104,587 (GRCm39) F275I probably benign Het
Slc50a1 A T 3: 89,177,207 (GRCm39) I70N probably damaging Het
Sytl2 C G 7: 90,009,367 (GRCm39) T123R possibly damaging Het
Tlk1 T A 2: 70,579,671 (GRCm39) T214S probably benign Het
Tmco3 A G 8: 13,346,114 (GRCm39) probably benign Het
Trim71 T C 9: 114,344,914 (GRCm39) T335A probably benign Het
Zbtb47 T A 9: 121,592,499 (GRCm39) V273E possibly damaging Het
Other mutations in Elp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02477:Elp3 APN 14 65,800,760 (GRCm39) missense probably benign
R0052:Elp3 UTSW 14 65,768,975 (GRCm39) makesense probably null
R0333:Elp3 UTSW 14 65,828,042 (GRCm39) missense probably benign 0.05
R0513:Elp3 UTSW 14 65,800,695 (GRCm39) splice site probably null
R0980:Elp3 UTSW 14 65,815,402 (GRCm39) missense probably damaging 1.00
R1137:Elp3 UTSW 14 65,785,370 (GRCm39) missense probably damaging 0.99
R1259:Elp3 UTSW 14 65,785,388 (GRCm39) missense probably damaging 0.96
R1378:Elp3 UTSW 14 65,830,380 (GRCm39) missense probably benign
R1722:Elp3 UTSW 14 65,788,846 (GRCm39) missense probably benign 0.02
R1789:Elp3 UTSW 14 65,785,368 (GRCm39) missense probably damaging 1.00
R4125:Elp3 UTSW 14 65,797,630 (GRCm39) missense possibly damaging 0.64
R4196:Elp3 UTSW 14 65,785,451 (GRCm39) missense probably damaging 1.00
R4400:Elp3 UTSW 14 65,785,539 (GRCm39) missense possibly damaging 0.89
R4420:Elp3 UTSW 14 65,818,240 (GRCm39) missense probably damaging 1.00
R4516:Elp3 UTSW 14 65,785,326 (GRCm39) missense possibly damaging 0.46
R4764:Elp3 UTSW 14 65,820,378 (GRCm39) missense probably damaging 1.00
R4838:Elp3 UTSW 14 65,785,313 (GRCm39) critical splice donor site probably null
R5052:Elp3 UTSW 14 65,815,389 (GRCm39) missense probably damaging 1.00
R5111:Elp3 UTSW 14 65,797,685 (GRCm39) missense probably damaging 1.00
R5665:Elp3 UTSW 14 65,788,851 (GRCm39) missense possibly damaging 0.80
R5702:Elp3 UTSW 14 65,815,431 (GRCm39) missense probably damaging 1.00
R5754:Elp3 UTSW 14 65,785,439 (GRCm39) missense probably damaging 1.00
R5927:Elp3 UTSW 14 65,819,626 (GRCm39) missense probably damaging 1.00
R5999:Elp3 UTSW 14 65,768,989 (GRCm39) missense probably benign 0.01
R6378:Elp3 UTSW 14 65,830,420 (GRCm39) nonsense probably null
R6384:Elp3 UTSW 14 65,797,660 (GRCm39) missense probably damaging 1.00
R6601:Elp3 UTSW 14 65,784,488 (GRCm39) makesense probably null
R7263:Elp3 UTSW 14 65,802,782 (GRCm39) missense probably damaging 0.98
R7857:Elp3 UTSW 14 65,800,759 (GRCm39) missense probably benign 0.14
R8504:Elp3 UTSW 14 65,785,360 (GRCm39) missense probably benign 0.03
R8789:Elp3 UTSW 14 65,802,870 (GRCm39) missense probably damaging 1.00
R8853:Elp3 UTSW 14 65,815,390 (GRCm39) missense probably benign 0.31
R9056:Elp3 UTSW 14 65,797,582 (GRCm39) missense probably damaging 0.99
R9234:Elp3 UTSW 14 65,788,920 (GRCm39) missense probably damaging 1.00
R9311:Elp3 UTSW 14 65,823,788 (GRCm39) missense probably benign 0.02
R9551:Elp3 UTSW 14 65,797,634 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTGTTGGTATCTCTGGCC -3'
(R):5'- GCCAGCTGTGTGAATGATAATG -3'

Sequencing Primer
(F):5'- GGCCACATCTTCATAGACACTCTG -3'
(R):5'- TTTGGATGCCAAGGCCAG -3'
Posted On 2015-04-06