Incidental Mutation 'R3843:Nlrc3'
ID277260
Institutional Source Beutler Lab
Gene Symbol Nlrc3
Ensembl Gene ENSMUSG00000049871
Gene NameNLR family, CARD domain containing 3
SynonymsCLR16.2, Caterpiller 16.2, D230007K08Rik
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location3945007-3976632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3964964 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 194 (R194W)
Ref Sequence ENSEMBL: ENSMUSP00000155241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177551] [ENSMUST00000180200] [ENSMUST00000229884]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163478
Predicted Effect probably benign
Transcript: ENSMUST00000177551
AA Change: R210W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137628
Gene: ENSMUSG00000049871
AA Change: R210W

DomainStartEndE-ValueType
Pfam:NACHT 176 342 2e-34 PFAM
LRR 702 729 3.11e-2 SMART
LRR 730 757 2.27e-4 SMART
LRR 758 785 8.15e-1 SMART
LRR 786 813 2.17e-1 SMART
LRR 814 841 2.12e-4 SMART
LRR 842 869 3.42e0 SMART
LRR 870 897 7.67e-2 SMART
LRR 898 925 3.21e0 SMART
LRR 926 953 1.67e0 SMART
LRR 954 981 4.87e-4 SMART
LRR 982 1009 4.3e0 SMART
LRR 1010 1037 3.8e-6 SMART
LRR 1038 1065 4.47e-3 SMART
LRR 1066 1093 1.08e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180200
SMART Domains Protein: ENSMUSP00000137325
Gene: ENSMUSG00000049871

DomainStartEndE-ValueType
LRR 4 24 8.65e1 SMART
LRR 25 52 2.27e-4 SMART
LRR 53 80 8.15e-1 SMART
LRR 81 108 2.17e-1 SMART
LRR 109 136 2.12e-4 SMART
LRR 137 164 3.42e0 SMART
LRR 165 192 7.67e-2 SMART
LRR 193 220 3.21e0 SMART
LRR 221 248 1.67e0 SMART
LRR 249 276 4.87e-4 SMART
LRR 277 304 4.3e0 SMART
LRR 305 332 3.8e-6 SMART
LRR 333 360 4.47e-3 SMART
LRR 361 388 1.08e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229884
AA Change: R194W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a NOD-like receptor family member. The encoded protein is a cytosolic regulator of innate immunity. This protein directly interacts with stimulator of interferon genes (STING), to prevent its proper trafficking, resulting in disruption of STING-dependent activation of the innate immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced susceptibility to LPS-induced toxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Nlrc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Nlrc3 APN 16 3955166 missense probably damaging 1.00
IGL00943:Nlrc3 APN 16 3965117 missense possibly damaging 0.94
IGL01481:Nlrc3 APN 16 3963905 missense probably damaging 1.00
IGL01517:Nlrc3 APN 16 3947487 missense probably damaging 0.99
IGL01988:Nlrc3 APN 16 3953939 missense probably benign 0.43
IGL02306:Nlrc3 APN 16 3964824 missense probably damaging 1.00
IGL02515:Nlrc3 APN 16 3949459 splice site probably benign
IGL02795:Nlrc3 APN 16 3965285 missense probably damaging 0.99
IGL02897:Nlrc3 APN 16 3964074 missense possibly damaging 0.85
IGL02992:Nlrc3 APN 16 3954023 splice site probably benign
IGL03003:Nlrc3 APN 16 3964862 missense probably benign 0.03
IGL03381:Nlrc3 APN 16 3964315 missense probably benign 0.03
R0064:Nlrc3 UTSW 16 3964087 missense possibly damaging 0.82
R0064:Nlrc3 UTSW 16 3964087 missense possibly damaging 0.82
R0122:Nlrc3 UTSW 16 3958958 missense probably damaging 0.98
R0482:Nlrc3 UTSW 16 3965192 missense possibly damaging 0.81
R0601:Nlrc3 UTSW 16 3948249 splice site probably benign
R0622:Nlrc3 UTSW 16 3953968 missense probably benign 0.04
R0675:Nlrc3 UTSW 16 3948911 missense probably benign 0.01
R1595:Nlrc3 UTSW 16 3965302 missense probably benign 0.03
R1597:Nlrc3 UTSW 16 3963995 missense probably damaging 1.00
R2013:Nlrc3 UTSW 16 3965110 missense probably damaging 1.00
R2077:Nlrc3 UTSW 16 3963992 missense probably benign 0.35
R2327:Nlrc3 UTSW 16 3953440 missense probably damaging 1.00
R2872:Nlrc3 UTSW 16 3957326 missense possibly damaging 0.56
R2872:Nlrc3 UTSW 16 3957326 missense possibly damaging 0.56
R3037:Nlrc3 UTSW 16 3952408 missense probably damaging 1.00
R3794:Nlrc3 UTSW 16 3947875 missense probably benign 0.22
R4761:Nlrc3 UTSW 16 3963650 missense probably damaging 1.00
R5303:Nlrc3 UTSW 16 3963614 missense probably benign 0.15
R5375:Nlrc3 UTSW 16 3964753 missense possibly damaging 0.95
R5468:Nlrc3 UTSW 16 3964035 missense probably damaging 1.00
R5719:Nlrc3 UTSW 16 3963725 missense probably damaging 1.00
R5838:Nlrc3 UTSW 16 3953995 missense probably damaging 1.00
R5879:Nlrc3 UTSW 16 3964045 missense probably damaging 1.00
R5942:Nlrc3 UTSW 16 3949429 missense probably damaging 1.00
R6500:Nlrc3 UTSW 16 3952444 missense possibly damaging 0.79
R6600:Nlrc3 UTSW 16 3965074 missense probably benign 0.29
R6704:Nlrc3 UTSW 16 3965081 missense probably damaging 0.99
R7172:Nlrc3 UTSW 16 3963753 missense probably benign 0.30
R7283:Nlrc3 UTSW 16 3947877 missense probably benign 0.25
R7296:Nlrc3 UTSW 16 3963590 missense probably damaging 0.99
R7477:Nlrc3 UTSW 16 3964811 missense probably damaging 0.99
R7817:Nlrc3 UTSW 16 3965463 missense possibly damaging 0.87
R8118:Nlrc3 UTSW 16 3965631 missense probably benign
R8559:Nlrc3 UTSW 16 3965282 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGCAGGCCATGGTATTGGAG -3'
(R):5'- AGCATGACTTCACACAGGTGG -3'

Sequencing Primer
(F):5'- CAGGCCATGGTATTGGAGAATTCC -3'
(R):5'- TTCACACAGGTGGAGGCC -3'
Posted On2015-04-06