Incidental Mutation 'R3843:Sidt1'
ID277261
Institutional Source Beutler Lab
Gene Symbol Sidt1
Ensembl Gene ENSMUSG00000022696
Gene NameSID1 transmembrane family, member 1
SynonymsB830021E24Rik
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location44240180-44333196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44284224 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 275 (F275I)
Ref Sequence ENSEMBL: ENSMUSP00000038433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047446] [ENSMUST00000136381]
Predicted Effect probably benign
Transcript: ENSMUST00000047446
AA Change: F275I

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000038433
Gene: ENSMUSG00000022696
AA Change: F275I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
Pfam:SID-1_RNA_chan 184 832 1.8e-290 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127124
Predicted Effect probably benign
Transcript: ENSMUST00000136381
AA Change: F275I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000115372
Gene: ENSMUSG00000022696
AA Change: F275I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
Pfam:SID-1_RNA_chan 184 827 1.3e-251 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147032
SMART Domains Protein: ENSMUSP00000114424
Gene: ENSMUSG00000022696

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Meta Mutation Damage Score 0.1115 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Hrh4 A G 18: 13,022,286 Y294C possibly damaging Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Sidt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00709:Sidt1 APN 16 44262011 splice site probably benign
IGL01103:Sidt1 APN 16 44243543 nonsense probably null
IGL01725:Sidt1 APN 16 44284282 missense probably benign 0.06
IGL02000:Sidt1 APN 16 44286369 missense probably damaging 0.98
IGL02266:Sidt1 APN 16 44254985 missense possibly damaging 0.90
IGL02309:Sidt1 APN 16 44254980 missense probably benign 0.00
IGL02898:Sidt1 APN 16 44282495 missense possibly damaging 0.87
R0282:Sidt1 UTSW 16 44281886 missense possibly damaging 0.79
R0525:Sidt1 UTSW 16 44259446 missense possibly damaging 0.64
R0927:Sidt1 UTSW 16 44243532 missense probably benign 0.00
R1806:Sidt1 UTSW 16 44281871 missense possibly damaging 0.46
R1911:Sidt1 UTSW 16 44281871 missense possibly damaging 0.81
R3848:Sidt1 UTSW 16 44255959 intron probably benign
R4023:Sidt1 UTSW 16 44281886 missense possibly damaging 0.79
R4026:Sidt1 UTSW 16 44281886 missense possibly damaging 0.79
R4495:Sidt1 UTSW 16 44282478 missense probably damaging 1.00
R4603:Sidt1 UTSW 16 44255026 missense probably damaging 0.98
R4707:Sidt1 UTSW 16 44269858 nonsense probably null
R5322:Sidt1 UTSW 16 44281622 intron probably benign
R5921:Sidt1 UTSW 16 44273735 splice site probably benign
R5980:Sidt1 UTSW 16 44263312 nonsense probably null
R5982:Sidt1 UTSW 16 44261708 missense probably damaging 1.00
R6063:Sidt1 UTSW 16 44259466 missense probably benign 0.01
R6337:Sidt1 UTSW 16 44300935 splice site probably null
R6392:Sidt1 UTSW 16 44291294 missense possibly damaging 0.47
R6855:Sidt1 UTSW 16 44245343 missense probably null 1.00
R7092:Sidt1 UTSW 16 44299829 missense possibly damaging 0.89
R7099:Sidt1 UTSW 16 44243497 missense probably damaging 1.00
R7448:Sidt1 UTSW 16 44286400 nonsense probably null
R7574:Sidt1 UTSW 16 44259485 missense probably damaging 1.00
Z1176:Sidt1 UTSW 16 44259482 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGAGGGACATTTTGTAGTAGTCATAC -3'
(R):5'- TCTGGGGACTTAGAGAGCCTG -3'

Sequencing Primer
(F):5'- GTTAGCCCCTCAGTAAGA -3'
(R):5'- ACTTAGAGAGCCTGGGTGG -3'
Posted On2015-04-06